Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIAS4 cdna clone

PIAS4 cDNA Clone

Gene Names
PIAS4; PIASY; Piasg; ZMIZ6; PIAS-gamma
Synonyms
PIAS4; PIAS4 cDNA Clone; PIAS4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggagctggtggaggccaaaaacatggtgatgagttttcgagtctccgaccttcagatgctcctgggtttcgtgggccggagtaagagtggactgaagcacgagctcgtcaccagggccctccagctggtgcagtttgactgtagccctgagctgttcaagaagatcaaggagctgtacgagacccgctacgccaagaagaactcggagcctgccccacagccgcaccggcccctggaccccctgaccatgcactccacctacgaccgggccggcgctgtgcccaggactccgctggcaggccccaatattgactaccccgtgctctacggaaagtacttaaacggactgggacggttgcccgccaagaccctcaagccagaagtccgcctggtgaagctgccgttctttaatatgctggatgagctgctgaagcccaccgaattagtcccacagaacaacgagaagcttcaggagagcccgtgcatcttcgcattgacgccaagacaggtggagttgatccggaactccagggaactgcagcccggagttaaagccgtgcaggtcgtcctgagaatctgttactcagacaccagctgccctcaggaggaccagtacccgcccaacatcgctgtgaaggtcaaccacagctactgctccgtcccgggctactacccctccaataagcccggggtggagcccaagaggccgtgccgccccatcaacctcactcacctcatgtacctgtcctcggccaccaaccgcatcactgtcacctgggggaactacggcaagagctactcggtggccctgtacctggtgcggcagctgacctcatcggagctgctgcagaggctgaagaccattggggtaaagcacccggagctgtgcaaggcactggtcaaggagaagctgcgccttgatcctgacagcgagatcgccaccaccggtgtgcgggtgtccctcatctgtccgctggtgaagatgcggctctccgtgccctgccgggcagagacctgcgcccacctgcagtgcttcgacgccgtcttctacctgcagatgaacgagaagaagcccacctggatgtgccccgtgtgcgacaagccagccccctacgaccagctcatcatcgacgggctcctctcgaagatcctgagcgagtgtgaggacgccgacgagatcgagtacctggtggacggctcgtggtgcccgatccgcgccgaaaaggagcgcagctgcagcccgcagggcgccatcctcgtgctgggcccctcggacgccaatgggctcctgcccgcccccagcgtcaacgggagcggtgccctgggcagcacgggtggcggcggcccggtgggcagcatggagaatgggaagccgggcgccgatgtggtggacctcacgctggacagctcatcgtcctcggaggatgaggaggagggggaagaggaggaggaagacgaggacgaagaggggccccggcccaagcgccgctgccccttccagaagggcctggtgccggcctgctga
Sequence Length
1533
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,504 Da
NCBI Official Full Name
Homo sapiens protein inhibitor of activated STAT, 4, mRNA
NCBI Official Synonym Full Names
protein inhibitor of activated STAT 4
NCBI Official Symbol
PIAS4
NCBI Official Synonym Symbols
PIASY; Piasg; ZMIZ6; PIAS-gamma
NCBI Protein Information
E3 SUMO-protein ligase PIAS4
UniProt Protein Name
E3 SUMO-protein ligase PIAS4
Protein Family
UniProt Gene Name
PIAS4
UniProt Synonym Gene Names
PIASG; PIAS-gamma
UniProt Entry Name
PIAS4_HUMAN

Uniprot Description

PIAS4: Functions as an E3-type small ubiquitin-like modifier (SUMO) ligase, stabilizing the interaction between UBE2I and the substrate, and as a SUMO-tethering factor. Plays a crucial role as a transcriptional coregulation in various cellular pathways, including the STAT pathway, the p53 pathway, the Wnt pathway and the steroid hormone signaling pathway. Involved in gene silencing. Promotes PARK7 sumoylation. In Wnt signaling, represses LEF1 and enhances TCF4 transcriptional activities through promoting their sumoylations. Interacts with AR, AXIN1, GATA2, LEF1, TP53 and STAT1 (IFNG-induced). Binds to AT-rich DNA sequences, known as matrix or scaffold attachment regions (MARs/SARs). Interacts with TICAM1. Interacts with KLF8; the interaction results in SUMO ligation and repression of KLF8 transcriptional activity and of its cell cycle progression into G(1) phase. Highly expressed in testis and, at lower levels, in spleen, prostate, ovary, colon and peripheral blood leukocytes. Belongs to the PIAS family.

Protein type: SUMO conjugating system; Nuclear receptor co-regulator; Transcription, coactivator/corepressor; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: protein binding; SUMO ligase activity; ubiquitin protein ligase binding

Biological Process: double-strand break repair via nonhomologous end joining; negative regulation of transcription, DNA-dependent; positive regulation of protein sumoylation; protein sumoylation

Research Articles on PIAS4

Similar Products

Product Notes

The PIAS4 pias4 (Catalog #AAA1273812) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg agctggtgga ggccaaaaac atggtgatga gttttcgagt ctccgacctt cagatgctcc tgggtttcgt gggccggagt aagagtggac tgaagcacga gctcgtcacc agggccctcc agctggtgca gtttgactgt agccctgagc tgttcaagaa gatcaaggag ctgtacgaga cccgctacgc caagaagaac tcggagcctg ccccacagcc gcaccggccc ctggaccccc tgaccatgca ctccacctac gaccgggccg gcgctgtgcc caggactccg ctggcaggcc ccaatattga ctaccccgtg ctctacggaa agtacttaaa cggactggga cggttgcccg ccaagaccct caagccagaa gtccgcctgg tgaagctgcc gttctttaat atgctggatg agctgctgaa gcccaccgaa ttagtcccac agaacaacga gaagcttcag gagagcccgt gcatcttcgc attgacgcca agacaggtgg agttgatccg gaactccagg gaactgcagc ccggagttaa agccgtgcag gtcgtcctga gaatctgtta ctcagacacc agctgccctc aggaggacca gtacccgccc aacatcgctg tgaaggtcaa ccacagctac tgctccgtcc cgggctacta cccctccaat aagcccgggg tggagcccaa gaggccgtgc cgccccatca acctcactca cctcatgtac ctgtcctcgg ccaccaaccg catcactgtc acctggggga actacggcaa gagctactcg gtggccctgt acctggtgcg gcagctgacc tcatcggagc tgctgcagag gctgaagacc attggggtaa agcacccgga gctgtgcaag gcactggtca aggagaagct gcgccttgat cctgacagcg agatcgccac caccggtgtg cgggtgtccc tcatctgtcc gctggtgaag atgcggctct ccgtgccctg ccgggcagag acctgcgccc acctgcagtg cttcgacgcc gtcttctacc tgcagatgaa cgagaagaag cccacctgga tgtgccccgt gtgcgacaag ccagccccct acgaccagct catcatcgac gggctcctct cgaagatcct gagcgagtgt gaggacgccg acgagatcga gtacctggtg gacggctcgt ggtgcccgat ccgcgccgaa aaggagcgca gctgcagccc gcagggcgcc atcctcgtgc tgggcccctc ggacgccaat gggctcctgc ccgcccccag cgtcaacggg agcggtgccc tgggcagcac gggtggcggc ggcccggtgg gcagcatgga gaatgggaag ccgggcgccg atgtggtgga cctcacgctg gacagctcat cgtcctcgga ggatgaggag gagggggaag aggaggagga agacgaggac gaagaggggc cccggcccaa gcgccgctgc cccttccaga agggcctggt gccggcctgc tga. It is sometimes possible for the material contained within the vial of "PIAS4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.