Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PI4KAP2 cdna clone

PI4KAP2 cDNA Clone

Synonyms
PI4KAP2; PI4KAP2 cDNA Clone; PI4KAP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacccccaggaaggccacgcgctcaggaggccccccccccgctggctgctgctcacatggtgtctgggcccttggcactccgttcatgcgggagatgacaggggctggcacatgacagtggagcagaaatttggcctgttttctgctgagataaaggaagcagaccccctggctgcctcggaagcaagtcaacccaaaccctgtccccccgaagtgaccccccactacatctggatcgacttcctggtgcagcggtttgagatcgccaagtactgcagctctgaccaagtggagatcttctccagcctgctgcagcgctccatgtccctgaacatcggcagggccaaggggagcatgaaccggcacgtggcggccatcgggccccgcttcaagctgctgaccctggggctgtccctcctgcatgccgatgtggttccaaatgcaaccatccgcaatgtgcttcgcgagaagatctactccactgcctttgactacttcagctgtcccccaaagtttcctactcaaggagagaagcggctgcgtgaagacataagcatcatgattaaattttggaccgccatgttctcagataagaagtacctgaccgccagccagcttgttcccccagctgacatcggcgacctcctggagcagttagtagaggagaacacaggctccttgtcgggcccagcgaaggacttttaccagcgggagtttgatttctttaacaagatcaccaacgtgtcggctatcatcaagccctaccctaaaggcgacgagagaaagaaggcttgtctgtcggccctgtctgaagtgacggtgcagccaggctgctccctgcccagcaaccccgaagccattgtgctggacgtcgactacaagtctgggaccccgatgcagagtgctgcaaaagccccatatctggccaagttcaaggtgaagcgatgtggagttagtgaacttgaaaaagaaggtctgcggtgccgctcagactctgaggatgagtgcagcacgcaggaggccgacggccagaagatctcctggcaggcagccatcttcaaactgggagacgactgccggcaggacatgctggccctgcagatcatcgacctcttcaagaacatcttccagctggtcggcctggacctctttgtttttccctaccgcgtggtggccactgcccctgggtgcggggtgatcgagtgcatccccgactgcacctcccgggaccagctgggccgccagacagacttcggcatgtacgactacttcacacgccagtacggggatgagtccactctggccttccagcaggcccgctacaacttcatccgaagcatggccgcctacagcctcctgctgttcctgctgcagatcaaggacagacacaacggcaacattatgctggacaagaagggccatatcatccacattgactttggcttcatgtttgaaagctcgccgggcggcaatctcggctgggaacccgacatcaagctgacggatgagatggtgatgatcatggggggcaagatggaggccacacccttcaagtggttcatggagatgtgtgtccgaggctacctggctgtgcggcacaggtttagccccaacatgactgagcgcgaggctgcaaatttcatcatgaaggtcatccagagctgcttcctcagcaacaggagccggacctacaacatgatccagtactatcagaatgacatcccctactga
Sequence Length
1734
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,178 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol 4-kinase alpha pseudogene 2
NCBI Official Symbol
PI4KAP2
UniProt Protein Name
Putative phosphatidylinositol 4-kinase alpha-like protein P2
UniProt Gene Name
PI4KAP2
UniProt Entry Name
PI4P2_HUMAN

Uniprot Description

PI4KAP2: Belongs to the PI3/PI4-kinase family. Type III PI4K subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, other

Chromosomal Location of Human Ortholog: 22q11.21

Cellular Component: plasma membrane

Molecular Function: 1-phosphatidylinositol 4-kinase activity

Similar Products

Product Notes

The PI4KAP2 pi4kap2 (Catalog #AAA1274208) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaccccc aggaaggcca cgcgctcagg aggccccccc cccgctggct gctgctcaca tggtgtctgg gcccttggca ctccgttcat gcgggagatg acaggggctg gcacatgaca gtggagcaga aatttggcct gttttctgct gagataaagg aagcagaccc cctggctgcc tcggaagcaa gtcaacccaa accctgtccc cccgaagtga ccccccacta catctggatc gacttcctgg tgcagcggtt tgagatcgcc aagtactgca gctctgacca agtggagatc ttctccagcc tgctgcagcg ctccatgtcc ctgaacatcg gcagggccaa ggggagcatg aaccggcacg tggcggccat cgggccccgc ttcaagctgc tgaccctggg gctgtccctc ctgcatgccg atgtggttcc aaatgcaacc atccgcaatg tgcttcgcga gaagatctac tccactgcct ttgactactt cagctgtccc ccaaagtttc ctactcaagg agagaagcgg ctgcgtgaag acataagcat catgattaaa ttttggaccg ccatgttctc agataagaag tacctgaccg ccagccagct tgttccccca gctgacatcg gcgacctcct ggagcagtta gtagaggaga acacaggctc cttgtcgggc ccagcgaagg acttttacca gcgggagttt gatttcttta acaagatcac caacgtgtcg gctatcatca agccctaccc taaaggcgac gagagaaaga aggcttgtct gtcggccctg tctgaagtga cggtgcagcc aggctgctcc ctgcccagca accccgaagc cattgtgctg gacgtcgact acaagtctgg gaccccgatg cagagtgctg caaaagcccc atatctggcc aagttcaagg tgaagcgatg tggagttagt gaacttgaaa aagaaggtct gcggtgccgc tcagactctg aggatgagtg cagcacgcag gaggccgacg gccagaagat ctcctggcag gcagccatct tcaaactggg agacgactgc cggcaggaca tgctggccct gcagatcatc gacctcttca agaacatctt ccagctggtc ggcctggacc tctttgtttt tccctaccgc gtggtggcca ctgcccctgg gtgcggggtg atcgagtgca tccccgactg cacctcccgg gaccagctgg gccgccagac agacttcggc atgtacgact acttcacacg ccagtacggg gatgagtcca ctctggcctt ccagcaggcc cgctacaact tcatccgaag catggccgcc tacagcctcc tgctgttcct gctgcagatc aaggacagac acaacggcaa cattatgctg gacaagaagg gccatatcat ccacattgac tttggcttca tgtttgaaag ctcgccgggc ggcaatctcg gctgggaacc cgacatcaag ctgacggatg agatggtgat gatcatgggg ggcaagatgg aggccacacc cttcaagtgg ttcatggaga tgtgtgtccg aggctacctg gctgtgcggc acaggtttag ccccaacatg actgagcgcg aggctgcaaa tttcatcatg aaggtcatcc agagctgctt cctcagcaac aggagccgga cctacaacat gatccagtac tatcagaatg acatccccta ctga. It is sometimes possible for the material contained within the vial of "PI4KAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.