PHYHD1 cdna clone
PHYHD1 cDNA Clone
Synonyms
PHYHD1; PHYHD1 cDNA Clone; PHYHD1 cdna clone
Sequence
atggcctgcctgagcccctcgcagctccagaagttccaacaggatggattcctggtgctggaaggattcttgtctgcggaagagtgtgtggccatgcaacaaaggattggcgagatagtggctgaaatggatgttcctctccactgccgcacagaattctccacccaggaagaggagcagcttcgagcccagggcagcacagactatttcttgagcagtggtgacaagattcgattcttctttgagaaaggcgtttttgatgagaaaggaaatttcctggtccctccggagaaatccatcaacaaaattggccacgctctgcacgcccatgaccccgtcttcaagagcatcacacactccttcaaggtgcagaccttggccagaagtctgggcctccagatgcccgtggtggtgcagagcatgtacatctttaagcaacctcactttggcggtgaagtctcccctcatcaggacgcctccttcctgtacacggagcccctgggccgggtgctgggcgtgtggatcgcagtggaggatgccacgctggagaacggctgtctctggttcatccctggctcccacaccagtggtgtgtcaagaaggatggtccgggcccctgttggctcagcgcctggtaccagcttccttgggtcagagccagcccgggataacagcctctttgtgcccaccccagtgcagagaggggccctggttctcatccatggagaagtggtacacaagagcaagcagaacctctctgaccgctcgcgccaggcctacactttccacctcatggaggcctctggcaccacctggagcccggagaactggctccagccaacagctgaactgccctttccccaactgtacacctaa
Sequence Length
876
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,668 Da
NCBI Official Full Name
Homo sapiens phytanoyl-CoA dioxygenase domain containing 1, mRNA
NCBI Official Synonym Full Names
phytanoyl-CoA dioxygenase domain containing 1
NCBI Official Symbol
PHYHD1
NCBI Protein Information
phytanoyl-CoA dioxygenase domain-containing protein 1
UniProt Protein Name
Phytanoyl-CoA dioxygenase domain-containing protein 1
Protein Family
UniProt Gene Name
PHYHD1
UniProt Entry Name
PHYD1_HUMAN
Uniprot Description
PHYHD1: Isoform 1 has alpha-ketoglutarate-dependent dioxygenase activity. Does not show detectable activity towards fatty acid CoA thioesters. Is not expected to be active with phytanoyl CoA. Isoform 2 and isoform 3 probably lack enzyme activity. Belongs to the PhyH family. PHYHD1 subfamily. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Oxidoreductase; EC 1.-.-.-
Chromosomal Location of Human Ortholog: 9q34.11
Molecular Function: protein binding
Research Articles on PHYHD1
Similar Products
Product Notes
The PHYHD1 phyhd1 (Catalog #AAA1266645) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctgcc tgagcccctc gcagctccag aagttccaac aggatggatt cctggtgctg gaaggattct tgtctgcgga agagtgtgtg gccatgcaac aaaggattgg cgagatagtg gctgaaatgg atgttcctct ccactgccgc acagaattct ccacccagga agaggagcag cttcgagccc agggcagcac agactatttc ttgagcagtg gtgacaagat tcgattcttc tttgagaaag gcgtttttga tgagaaagga aatttcctgg tccctccgga gaaatccatc aacaaaattg gccacgctct gcacgcccat gaccccgtct tcaagagcat cacacactcc ttcaaggtgc agaccttggc cagaagtctg ggcctccaga tgcccgtggt ggtgcagagc atgtacatct ttaagcaacc tcactttggc ggtgaagtct cccctcatca ggacgcctcc ttcctgtaca cggagcccct gggccgggtg ctgggcgtgt ggatcgcagt ggaggatgcc acgctggaga acggctgtct ctggttcatc cctggctccc acaccagtgg tgtgtcaaga aggatggtcc gggcccctgt tggctcagcg cctggtacca gcttccttgg gtcagagcca gcccgggata acagcctctt tgtgcccacc ccagtgcaga gaggggccct ggttctcatc catggagaag tggtacacaa gagcaagcag aacctctctg accgctcgcg ccaggcctac actttccacc tcatggaggc ctctggcacc acctggagcc cggagaactg gctccagcca acagctgaac tgccctttcc ccaactgtac acctaa. It is sometimes possible for the material contained within the vial of "PHYHD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
