Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHYH cdna clone

PHYH cDNA Clone

Gene Names
PHYH; RD; LN1; PAHX; LNAP1; PHYH1
Synonyms
PHYH; PHYH cDNA Clone; PHYH cdna clone
Ordering
For Research Use Only!
Sequence
atggagcagcttcgcgccgccgcccgtctgcagattgttctgggccacctcggccgcccctcggccggggctgtcgtagctcatcccacttcagggactatttcctctgccagtttccatcctcaacaattccagtatactctggataataatgttctaaccctggaacagagaaaattttatgaagaaaatgggtttctagtaatcaaaaatcttgtacctgatgccgatattcaacgctttcggaatgagtttgaaaaaatctgcagaaaggaggtgaaaccattaggattaacagtaatgagagatgtgaccatttcgaaatccgaatatgctccaagtgagaagatgatcacgaaggtccaggatttccaggaagataaggagctcttcagatactgcactctccccgagattctgaaatatgtggagtgcttcactggacctaatattatggccatgcacacaatgttgataaacaaacctccagattctggcaagaagacgtcccgtcaccccctgcaccaggacctgcactatttccccttcaggcccagcgatctcatcgtttgcgcctggacggcgatggagcacatcagccggaacaacggctgtctggttgtgctcccaggcacacacaagggctccctgaagccccacgattaccccaagtgggaggggggagttaacaaaatgttccacgggatccaggactacgaggaaaacaaggcccgggtgcacctggtgatggagaagggcgacactgttttcttccatcctttgctcatccacggatctggtcagaataaaacccagggattccggaaggcaatttcctgccatttcgccagtgccgattgccactacattgacgtgaagggcaccagtcaagaaaacatcgagaaggaagttgtaggaatagcacataaattctttggagctgaaaatagcgtgaacttgaaggatatttggatgtttcgagctcgacttgtgaaaggagaaagaaccaatctttga
Sequence Length
1017
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,291 Da
NCBI Official Full Name
Homo sapiens phytanoyl-CoA 2-hydroxylase, mRNA
NCBI Official Synonym Full Names
phytanoyl-CoA 2-hydroxylase
NCBI Official Symbol
PHYH
NCBI Official Synonym Symbols
RD; LN1; PAHX; LNAP1; PHYH1
NCBI Protein Information
phytanoyl-CoA dioxygenase, peroxisomal
UniProt Protein Name
Phytanoyl-CoA dioxygenase, peroxisomal
Protein Family
UniProt Gene Name
PHYH
UniProt Synonym Gene Names
PAHX; PhyH
UniProt Entry Name
PAHX_HUMAN

NCBI Description

This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

PHYH: Converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH are a cause of Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues. Less constant features are nerve deafness, anosmia, skeletal abnormalities, ichthyosis, cataracts and cardiac impairment. Manifestations of the disease appear in the second or third decade of life. Belongs to the PhyH family.

Protein type: EC 1.14.11.18; Oxidoreductase

Chromosomal Location of Human Ortholog: 10p13

Cellular Component: peroxisomal matrix; peroxisome

Molecular Function: cofactor binding; phytanoyl-CoA dioxygenase activity; protein binding

Biological Process: fatty acid alpha-oxidation; isoprenoid metabolic process

Disease: Refsum Disease, Classic

Research Articles on PHYH

Similar Products

Product Notes

The PHYH phyh (Catalog #AAA1267960) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcagc ttcgcgccgc cgcccgtctg cagattgttc tgggccacct cggccgcccc tcggccgggg ctgtcgtagc tcatcccact tcagggacta tttcctctgc cagtttccat cctcaacaat tccagtatac tctggataat aatgttctaa ccctggaaca gagaaaattt tatgaagaaa atgggtttct agtaatcaaa aatcttgtac ctgatgccga tattcaacgc tttcggaatg agtttgaaaa aatctgcaga aaggaggtga aaccattagg attaacagta atgagagatg tgaccatttc gaaatccgaa tatgctccaa gtgagaagat gatcacgaag gtccaggatt tccaggaaga taaggagctc ttcagatact gcactctccc cgagattctg aaatatgtgg agtgcttcac tggacctaat attatggcca tgcacacaat gttgataaac aaacctccag attctggcaa gaagacgtcc cgtcaccccc tgcaccagga cctgcactat ttccccttca ggcccagcga tctcatcgtt tgcgcctgga cggcgatgga gcacatcagc cggaacaacg gctgtctggt tgtgctccca ggcacacaca agggctccct gaagccccac gattacccca agtgggaggg gggagttaac aaaatgttcc acgggatcca ggactacgag gaaaacaagg cccgggtgca cctggtgatg gagaagggcg acactgtttt cttccatcct ttgctcatcc acggatctgg tcagaataaa acccagggat tccggaaggc aatttcctgc catttcgcca gtgccgattg ccactacatt gacgtgaagg gcaccagtca agaaaacatc gagaaggaag ttgtaggaat agcacataaa ttctttggag ctgaaaatag cgtgaacttg aaggatattt ggatgtttcg agctcgactt gtgaaaggag aaagaaccaa tctttga. It is sometimes possible for the material contained within the vial of "PHYH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.