Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF21A cdna clone

PHF21A cDNA Clone

Gene Names
PHF21A; BHC80; BM-006
Synonyms
PHF21A; PHF21A cDNA Clone; PHF21A cdna clone
Ordering
For Research Use Only!
Sequence
atggagttgcagactctacaggaggctcttaaagtggaaattcaggttcaccagaaactggttgctcaaatgaagcaggatccacagaatgctgacttaaagaaacagcttcatgaactccaagccaaaatcacagctttgagtgagaaacagaaaagagtagttgaacagctacggaagaacctgatagtaaagcaagaacaaccggacaagttccaaatacagccattgccacaatctgaaaacaaactacaaacagcacagcagcaaccactacagcaactacaacaacagcagcagtaccaccaccaccacgcccagcagtcagctgcagcctctcccaacctgactgcttcacagaagactgtaactacagcttctatgattaccacaaagacactacctctcgtcttgaaagcagcaactgcgaccatgcctgcctctgtggtgggccagagacctaccattgctatggtgaccgccatcaacagtcagaaggctgtgctcagcactgatgtgcagaacacaccagtcaacctccagacgtctagtaaggtcactgggcctggggcagaggctgtccaaattgtggcaaaaaacacagtcactctggttcaggcaacacctcctcagcccatcaaagtaccacagtttatcccccctcctagactcactccacgtccaaactttcttccacaggttcgacccaagcctgtggcccagaataacattcctattgccccagcaccacctcccatgctcgcagctcctcagcttatccagaggcccgtcatgctgaccaagttcacccccacaacccttcccacatcccagaattccatccaccccgtccgtgtcgtcaatgggcagactgcaaccatagccaaaacgttccccatggcccagctcaccagcattgtgatagctactccagggaccagactcgctggacctcaaactgtacagcttagcaagccaagtcttgaaaaacagacagttaaatctcacacagaaacagatgagaaacaaacagagagccgcaccatcaccccacctgctgcacccaaaccaaaacgggaggagaaccctcagaaacttgccttcatggtgtctctagggttggtaacacatgaccatctagaagaaatccaaagcaagaggcaagagcgaaaaagaagaacaacagcaaatccggtctacagtggagcagtctttgagccagagcgtaagaagagtgcagtgacatacctaaacagcacaatgcaccctgggacccggaagagaggtcgtcctccaaaatacaatgcagtgctggggtttggagcccttaccccaacatccccccaatccagtcatcctgactcccctgaaaatgaaaagacagagaccacattcactttccctgcacctgttcagcctgtgtccctgcccagccccacctccacagacggtgatattcatgaggatttttgcagcgtttgcagaaaaagtggccagttactgatgtgcgacacatgttcccgtgtatatcatttggactgcttagacccccctctgaaaacaattcccaagggcatgtggatctgtcccagatgtcaggaccagatgctgaagaaggaagaagcaattccatggcctggaactttagcaattgttcattcctatattgcctacaaagcagcaaaagaagaagagaaacagaagttacttaaatggagttcagatttaaaacaagaacgagaacaactagagcaaaaggtgaaacagctcagcaattccataagtaaatgcatggaaatgaagaacaccatcctggcccggcagaaggagatgcacagctccctggagaaggtaaaacagctgattcgcctcatccacggcatcgacctctccaaacctgtagactctgaggccactgtgggggccatctccaatggcccggactgcaccccccctgccaatgccgccacctccacgccggccccttccccctcctcccagagctgcacagcgaactgtaaccagggggaagagactaaataa
Sequence Length
2043
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,982 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 21A, mRNA
NCBI Official Synonym Full Names
PHD finger protein 21A
NCBI Official Symbol
PHF21A
NCBI Official Synonym Symbols
BHC80; BM-006
NCBI Protein Information
PHD finger protein 21A
UniProt Protein Name
PHD finger protein 21A
Protein Family
UniProt Gene Name
PHF21A
UniProt Synonym Gene Names
BHC80; KIAA1696
UniProt Entry Name
PF21A_HUMAN

NCBI Description

The PHF21A gene encodes BHC80, a component of a BRAF35 (MIM 605535)/histone deacetylase (HDAC; see MIM 601241) complex (BHC) that mediates repression of neuron-specific genes through the cis-regulatory element known as repressor element-1 (RE1) or neural restrictive silencer (NRS) (Hakimi et al., 2002 [PubMed 12032298]).[supplied by OMIM, Nov 2010]

Uniprot Description

PHF21A: Component of the BHC complex, a corepressor complex that represses transcription of neuron-specific genes in non-neuronal cells. The BHC complex is recruited at RE1/NRSE sites by REST and acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. In the BHC complex, it may act as a scaffold. Inhibits KDM1A-mediated demethylation of 'Lys-4' of histone H3 in vitro, suggesting a role in demethylation regulation. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: histone deacetylase complex; nucleoplasm

Molecular Function: chromatin binding; histone binding; histone deacetylase activity; protein binding; transcription cofactor activity

Biological Process: blood coagulation

Research Articles on PHF21A

Similar Products

Product Notes

The PHF21A phf21a (Catalog #AAA1275879) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagttgc agactctaca ggaggctctt aaagtggaaa ttcaggttca ccagaaactg gttgctcaaa tgaagcagga tccacagaat gctgacttaa agaaacagct tcatgaactc caagccaaaa tcacagcttt gagtgagaaa cagaaaagag tagttgaaca gctacggaag aacctgatag taaagcaaga acaaccggac aagttccaaa tacagccatt gccacaatct gaaaacaaac tacaaacagc acagcagcaa ccactacagc aactacaaca acagcagcag taccaccacc accacgccca gcagtcagct gcagcctctc ccaacctgac tgcttcacag aagactgtaa ctacagcttc tatgattacc acaaagacac tacctctcgt cttgaaagca gcaactgcga ccatgcctgc ctctgtggtg ggccagagac ctaccattgc tatggtgacc gccatcaaca gtcagaaggc tgtgctcagc actgatgtgc agaacacacc agtcaacctc cagacgtcta gtaaggtcac tgggcctggg gcagaggctg tccaaattgt ggcaaaaaac acagtcactc tggttcaggc aacacctcct cagcccatca aagtaccaca gtttatcccc cctcctagac tcactccacg tccaaacttt cttccacagg ttcgacccaa gcctgtggcc cagaataaca ttcctattgc cccagcacca cctcccatgc tcgcagctcc tcagcttatc cagaggcccg tcatgctgac caagttcacc cccacaaccc ttcccacatc ccagaattcc atccaccccg tccgtgtcgt caatgggcag actgcaacca tagccaaaac gttccccatg gcccagctca ccagcattgt gatagctact ccagggacca gactcgctgg acctcaaact gtacagctta gcaagccaag tcttgaaaaa cagacagtta aatctcacac agaaacagat gagaaacaaa cagagagccg caccatcacc ccacctgctg cacccaaacc aaaacgggag gagaaccctc agaaacttgc cttcatggtg tctctagggt tggtaacaca tgaccatcta gaagaaatcc aaagcaagag gcaagagcga aaaagaagaa caacagcaaa tccggtctac agtggagcag tctttgagcc agagcgtaag aagagtgcag tgacatacct aaacagcaca atgcaccctg ggacccggaa gagaggtcgt cctccaaaat acaatgcagt gctggggttt ggagccctta ccccaacatc cccccaatcc agtcatcctg actcccctga aaatgaaaag acagagacca cattcacttt ccctgcacct gttcagcctg tgtccctgcc cagccccacc tccacagacg gtgatattca tgaggatttt tgcagcgttt gcagaaaaag tggccagtta ctgatgtgcg acacatgttc ccgtgtatat catttggact gcttagaccc ccctctgaaa acaattccca agggcatgtg gatctgtccc agatgtcagg accagatgct gaagaaggaa gaagcaattc catggcctgg aactttagca attgttcatt cctatattgc ctacaaagca gcaaaagaag aagagaaaca gaagttactt aaatggagtt cagatttaaa acaagaacga gaacaactag agcaaaaggt gaaacagctc agcaattcca taagtaaatg catggaaatg aagaacacca tcctggcccg gcagaaggag atgcacagct ccctggagaa ggtaaaacag ctgattcgcc tcatccacgg catcgacctc tccaaacctg tagactctga ggccactgtg ggggccatct ccaatggccc ggactgcacc ccccctgcca atgccgccac ctccacgccg gccccttccc cctcctccca gagctgcaca gcgaactgta accaggggga agagactaaa taa. It is sometimes possible for the material contained within the vial of "PHF21A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.