PGRMC2 cdna clone
PGRMC2 cDNA Clone
Gene Names
PGRMC2; DG6; PMBP
Synonyms
PGRMC2; PGRMC2 cDNA Clone; PGRMC2 cdna clone
Sequence
atggcggctggtgatggggacgtgaagctaggcaccctggggagtggcagcgagagcagcaacgacggcggcagcgagagtccaggcgacgcgggagcggcagcggaagggggaggctgggcggcggcggcgttggcgcttctgacggggggcggggaaatgctgctgaacgtggcgctggtggctctggtgctgctgggggcctaccggctgtgggtgcgctgggggcggcggggtctgggggccggggccggggcgggcgaggagagccccgccacctctctgcctcgcatgaagaagcgggacttcagcttggagcagctgcgccagtacgacggctcccgcaacccgcgcatcctgctcgcggtcaatgggaaagtcttcgacgtgaccaaaggcagcaagttctacggcccggcgggtccatatggaatatttgctggtagggatgcctccagaggactggccacattttgcctagataaagatgcacttagagatgaatatgatgatctctcagatttgaatgcagtacaaatggagagtgttcgagaatgggaaatgcagtttaaagaaaaatatgattatgtaggcagactcctaaaaccaggagaagaaccatcagaatatacagatgaagaagataccaaggatcacaataaacaggattga
Sequence Length
672
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,170 Da
NCBI Official Full Name
Homo sapiens progesterone receptor membrane component 2, mRNA
NCBI Official Synonym Full Names
progesterone receptor membrane component 2
NCBI Official Symbol
PGRMC2
NCBI Official Synonym Symbols
DG6; PMBP
NCBI Protein Information
membrane-associated progesterone receptor component 2
UniProt Protein Name
Membrane-associated progesterone receptor component 2
Protein Family
UniProt Gene Name
PGRMC2
UniProt Synonym Gene Names
DG6; PMBP
UniProt Entry Name
PGRC2_HUMAN
Uniprot Description
PGRMC2: Receptor for steroids (Potential). Belongs to the cytochrome b5 family. MAPR subfamily.
Protein type: Receptor, misc.; Membrane protein, integral
Chromosomal Location of Human Ortholog: 4q26
Cellular Component: endomembrane system; membrane; nuclear envelope
Molecular Function: heme binding; steroid hormone receptor activity
Research Articles on PGRMC2
Similar Products
Product Notes
The PGRMC2 pgrmc2 (Catalog #AAA1272912) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg gtgatgggga cgtgaagcta ggcaccctgg ggagtggcag cgagagcagc aacgacggcg gcagcgagag tccaggcgac gcgggagcgg cagcggaagg gggaggctgg gcggcggcgg cgttggcgct tctgacgggg ggcggggaaa tgctgctgaa cgtggcgctg gtggctctgg tgctgctggg ggcctaccgg ctgtgggtgc gctgggggcg gcggggtctg ggggccgggg ccggggcggg cgaggagagc cccgccacct ctctgcctcg catgaagaag cgggacttca gcttggagca gctgcgccag tacgacggct cccgcaaccc gcgcatcctg ctcgcggtca atgggaaagt cttcgacgtg accaaaggca gcaagttcta cggcccggcg ggtccatatg gaatatttgc tggtagggat gcctccagag gactggccac attttgccta gataaagatg cacttagaga tgaatatgat gatctctcag atttgaatgc agtacaaatg gagagtgttc gagaatggga aatgcagttt aaagaaaaat atgattatgt aggcagactc ctaaaaccag gagaagaacc atcagaatat acagatgaag aagataccaa ggatcacaat aaacaggatt ga. It is sometimes possible for the material contained within the vial of "PGRMC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
