Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PGC cdna clone

PGC cDNA Clone

Gene Names
PGC; PEPC; PGII
Synonyms
PGC; PGC cDNA Clone; PGC cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtggatggtggtggtcttggtctgcctccagctcttggaggcagcagtggtcaaagtgcccctgaagaaatttaagtctatccgtgagaccatgaaggagaagggcttgctgggggagttcctgaggacccacaagtatgatcctgcttggaagtaccgctttggtgacctcagcgtgacctacgagcccatggcctacatggatgctgcctactttggtgagatcagcatcgggactccaccccagaacttcctggtcctttttgacaccggctcctcccctcttcctcttgaccctgcaccctcctag
Sequence Length
315
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,208 Da
NCBI Official Full Name
Homo sapiens progastricsin (pepsinogen C), mRNA
NCBI Official Synonym Full Names
progastricsin
NCBI Official Symbol
PGC
NCBI Official Synonym Symbols
PEPC; PGII
NCBI Protein Information
gastricsin
UniProt Protein Name
Gastricsin
UniProt Gene Name
PGC
UniProt Entry Name
PEPC_HUMAN

NCBI Description

This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]

Uniprot Description

PGC: Hydrolyzes a variety of proteins. Belongs to the peptidase A1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.23.3; Protease; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 6p21.1

Cellular Component: extracellular space

Molecular Function: aspartic-type endopeptidase activity

Biological Process: positive regulation of antibacterial peptide production; protein catabolic process

Research Articles on PGC

Similar Products

Product Notes

The PGC pgc (Catalog #AAA1278918) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtgga tggtggtggt cttggtctgc ctccagctct tggaggcagc agtggtcaaa gtgcccctga agaaatttaa gtctatccgt gagaccatga aggagaaggg cttgctgggg gagttcctga ggacccacaa gtatgatcct gcttggaagt accgctttgg tgacctcagc gtgacctacg agcccatggc ctacatggat gctgcctact ttggtgagat cagcatcggg actccacccc agaacttcct ggtccttttt gacaccggct cctcccctct tcctcttgac cctgcaccct cctag. It is sometimes possible for the material contained within the vial of "PGC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.