Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PFKL cdna clone

PFKL cDNA Clone

Gene Names
PFKL; PFK-B; PFK-L; ATP-PFK
Synonyms
PFKL; PFKL cDNA Clone; PFKL cdna clone
Ordering
For Research Use Only!
Sequence
atgggcatggaggcggtgatggcgctgctggaagccacgcctgacacgccggcctgcgtggtcaccctctcggggaaccagtcagtgcggctgcccctcatggagtgcgtgcagatgaccaaggaagtgcagaaagccatggatgacaagaggtttgacgaggccacccagctccgtggtgggagcttcgagaacaactggaacatttacaagctcctcgcccaccagaagccccccaaggagaagtctaacttctccctggccatcctgaatgtgggggccccggcggctggcatgaatgcggccgtgcgctcggcggtgcggaccggcatctcccatggacacacagtatacgtggtgcacgatggcttcgaaggcctagccaagggtcaggtgcaagaagtaggctggcacgacgtggccggctggttggggcgtggtggctccatgctggggaccaagaggaccctgcccaagggccagctggagtccattgtggagaacatccgcatctatggtattcacgccctgctggtggtcggtgggtttgaggcctatgaaggggtgctgcagctggtggaggctcgcgggcgctacgaggagctctgcatcgtcatgtgtgtcatcccagccaccatcagcaacaacgtccctggcaccgacttcagcctgggctccgacactgctgtaaatgccgccatggagagctgtgaccgcatcaaacagtctgcctcggggaccaagcgccgtgtgttcatcgtggagaccatggggggttactgtggctacctggccaccgtgactggcattgctgtgggggccgacgccgcctacgtcttcgaggaccctttcaacatccacgacttaaaggtcaacgtggagcacatgacggagaagatgaagacagacattcagaggggcctggtgctgcggaacgagaagtgccatgactactacaccacggagttcctgtacaacctgtactcatcagagggcaagggcgtcttcgactgcaggaccaatgtcctgggccacctgcagcagggtggcgctccaaccccctttgaccggaactatgggaccaagctgggggtgaaggccatgctgtggttgtcggagaagctgcgcgaggtttaccgcaagggacgggtgttcgccaatgccccagactcggcctgcgtgatcggcctgaagaagaaggcggtggccttcagccccgtcactgagctcaagaaagacactgatttcgagcaccgcatgccacgggagcagtggtggctgagcctgcggctcatgctgaagatgctggcacaataccgcatcagtatggccgcctacgtgtcaggggagctggagcacgtgacccgccgcaccctgagcatggacaagggcttctga
Sequence Length
1398
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,203 Da
NCBI Official Full Name
Homo sapiens phosphofructokinase, liver, mRNA
NCBI Official Synonym Full Names
phosphofructokinase, liver type
NCBI Official Symbol
PFKL
NCBI Official Synonym Symbols
PFK-B; PFK-L; ATP-PFK
NCBI Protein Information
ATP-dependent 6-phosphofructokinase, liver type
UniProt Protein Name
ATP-dependent 6-phosphofructokinase, liver type
UniProt Gene Name
PFKL
UniProt Synonym Gene Names
ATP-PFK; PFK-L
UniProt Entry Name
PFKAL_HUMAN

NCBI Description

This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Uniprot Description

PFKL: phosphofructokinase, liver type. An ubiquitous metabolic enzyme involved in the synthesis and degradation of fructose 2,6-bisphosphate. Key control step of glycolysis. An allosteric enzyme activated by ADP, AMP, or fructose bisphosphate and inhibited by ATP or citrate. Activity: ATP D-fructose 6-phosphate = ADP D-fructose 1,6-bisphosphate. The holoenzyme consists of 4 subunits. The liver and muscle enzymes are homo-tetramers of four liver or muscle isoforms, respectively. The red blood cell enzyme consists hetero-tetramers of the muscle and liver isoforms. A subunit composition with a higher proportion of platelet type subunits is found in platelets, brain and fibroblasts. Two alternatively spliced isoforms have been described.

Protein type: Carbohydrate Metabolism - galactose; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Carbohydrate Metabolism - pentose phosphate pathway; Carbohydrate Metabolism - fructose and mannose; EC 2.7.1.11; Kinase, other

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: 6-phosphofructokinase complex; cytosol; membrane

Molecular Function: 6-phosphofructokinase activity; ATP binding; identical protein binding; kinase binding; protein binding

Biological Process: fructose 1,6-bisphosphate metabolic process; fructose 6-phosphate metabolic process; glycolysis; protein oligomerization; response to glucose stimulus

Research Articles on PFKL

Similar Products

Product Notes

The PFKL pfkl (Catalog #AAA1276502) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcatgg aggcggtgat ggcgctgctg gaagccacgc ctgacacgcc ggcctgcgtg gtcaccctct cggggaacca gtcagtgcgg ctgcccctca tggagtgcgt gcagatgacc aaggaagtgc agaaagccat ggatgacaag aggtttgacg aggccaccca gctccgtggt gggagcttcg agaacaactg gaacatttac aagctcctcg cccaccagaa gccccccaag gagaagtcta acttctccct ggccatcctg aatgtggggg ccccggcggc tggcatgaat gcggccgtgc gctcggcggt gcggaccggc atctcccatg gacacacagt atacgtggtg cacgatggct tcgaaggcct agccaagggt caggtgcaag aagtaggctg gcacgacgtg gccggctggt tggggcgtgg tggctccatg ctggggacca agaggaccct gcccaagggc cagctggagt ccattgtgga gaacatccgc atctatggta ttcacgccct gctggtggtc ggtgggtttg aggcctatga aggggtgctg cagctggtgg aggctcgcgg gcgctacgag gagctctgca tcgtcatgtg tgtcatccca gccaccatca gcaacaacgt ccctggcacc gacttcagcc tgggctccga cactgctgta aatgccgcca tggagagctg tgaccgcatc aaacagtctg cctcggggac caagcgccgt gtgttcatcg tggagaccat ggggggttac tgtggctacc tggccaccgt gactggcatt gctgtggggg ccgacgccgc ctacgtcttc gaggaccctt tcaacatcca cgacttaaag gtcaacgtgg agcacatgac ggagaagatg aagacagaca ttcagagggg cctggtgctg cggaacgaga agtgccatga ctactacacc acggagttcc tgtacaacct gtactcatca gagggcaagg gcgtcttcga ctgcaggacc aatgtcctgg gccacctgca gcagggtggc gctccaaccc cctttgaccg gaactatggg accaagctgg gggtgaaggc catgctgtgg ttgtcggaga agctgcgcga ggtttaccgc aagggacggg tgttcgccaa tgccccagac tcggcctgcg tgatcggcct gaagaagaag gcggtggcct tcagccccgt cactgagctc aagaaagaca ctgatttcga gcaccgcatg ccacgggagc agtggtggct gagcctgcgg ctcatgctga agatgctggc acaataccgc atcagtatgg ccgcctacgt gtcaggggag ctggagcacg tgacccgccg caccctgagc atggacaagg gcttctga. It is sometimes possible for the material contained within the vial of "PFKL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.