Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PER1 cdna clone

PER1 cDNA Clone

Gene Names
PER1; PER; hPER; RIGUI
Synonyms
PER1; PER1 cDNA Clone; PER1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtggccccctagaaggggctgatgggggaggggaccccaggcctggggaatcattttgtcctgggggcgtcccatcccctgggcccccacagcaccggccttgcccaggccccagcctggccgatgacaccgatgccaacagcaatggttcaagtggcaatgagtccaacgggcatgagtctagaggcgcatctcagcggagctcacacagctcctcctcaggcaacggcaaggactcagccctgctggagaccactgagagcagcaagagcacaaactctcagagcccatccccacccagcagttccattgcctacagcctcctgagtgccagctcagagcaggacaacccgtccaccagtggctgcagcagtgaacagtcagcccgggcaaggactcagaaggaactcatgacagcacttcgagagctcaagcttcgactgccgccagagcgccggggcaagggccgctctgggaccctggccacgctgcagtacgcactggcctgtgtcaagcaggtgcaggccaaccaggaatactaccagcagtggagcctggaggagggcgagccttgctccatggacatgtccacctataccctggaggagctggagcacatcacgtctgagtacacacttcagaaccaggataccttctcagtggctgtctccttcctgacgggccgaatcgtctacatttcggagcaggcagccgtcctgctgcgttgcaagcgggacgtgttccggggtacccgcttctctgagctcctggctccccaggatgtgggagtcttctatggttccactgctccatctcgcctgcccacctggggcacaggggcctcagcaggttcaggcctcagggactttacccaggagaagtccgtcttctgccgtatcagaggaggtcctgaccgggatccagggcctcggtaccagccattccgcctaaccccgtatgtgaccaagatccgggtctcagatggggcccctgcacagccgtgctgcctgctgattgcagagcgcatccattcgggttacgaagctccccggataccccctgacaagaggattttcactacgcggcacacacccagctgcctcttccaggatgtggatgaaagggctgcccccctgctgggctacctgccccaggacctcctgggggccccagtgctcctgttcctgcatcctgaggaccgacccctcatgctggctatccacaagaagattctgcagttggcgggccagccctttgaccactcccctatccgcttctgtgcccgcaacggggagtatgtcaccatggacaccagctgggctggctttgtgcacccctggagccgcaaggtagccttcgtgttgggccgccacaaagtacgcacggcccccctgaatgaggacgtgttcactcccccggcccccagcccagctccctccctggacactgatatccaggagctgtcagagcagatccaccggctgctgctgcagcccgtccacagccccagccccacgggactctgtggagtcggcgccgtgacatccccaggccctctccacagccctgggtcctccagtgatagcaacgggggtgatgcagaggggcctgggcctcctgcgccactacaggcacgttcaaggccaaggcccttccctgccaatccccagacccagagctggaggcgggttctgctcccgtccaggccccactag
Sequence Length
1719
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
– Da
NCBI Official Full Name
Homo sapiens period homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
period circadian clock 1
NCBI Official Symbol
PER1
NCBI Official Synonym Symbols
PER; hPER; RIGUI
NCBI Protein Information
period circadian protein homolog 1
UniProt Protein Name
Period circadian protein homolog 1
Protein Family
UniProt Gene Name
PER1
UniProt Synonym Gene Names
KIAA0482; PER; RIGUI; hPER1
UniProt Entry Name
PER1_HUMAN

NCBI Description

This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene may increase the risk of getting certain cancers. Alternative splicing has been observed in this gene; however, these variants have not been fully described. [provided by RefSeq, Jan 2014]

Uniprot Description

PER1: Component of the circadian clock mechanism which is essential for generating circadian rhythms. Negative element in the circadian transcriptional loop. Influences clock function by interacting with other circadian regulatory proteins and transporting them to the nucleus. Negatively regulates CLOCK|NPAS2-BMAL1|BMAL2-induced transactivation. Can bind heme. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 17p13.1

Cellular Component: cytoplasm

Molecular Function: chromatin DNA binding; kinase binding; ubiquitin protein ligase binding

Biological Process: circadian regulation of gene expression; circadian rhythm; entrainment of circadian clock; entrainment of circadian clock by photoperiod; negative regulation of I-kappaB kinase/NF-kappaB cascade; negative regulation of JNK cascade; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase II promoter; regulation of circadian rhythm; regulation of hair cycle; regulation of sodium ion transport

Research Articles on PER1

Similar Products

Product Notes

The PER1 per1 (Catalog #AAA1269594) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtggcc ccctagaagg ggctgatggg ggaggggacc ccaggcctgg ggaatcattt tgtcctgggg gcgtcccatc ccctgggccc ccacagcacc ggccttgccc aggccccagc ctggccgatg acaccgatgc caacagcaat ggttcaagtg gcaatgagtc caacgggcat gagtctagag gcgcatctca gcggagctca cacagctcct cctcaggcaa cggcaaggac tcagccctgc tggagaccac tgagagcagc aagagcacaa actctcagag cccatcccca cccagcagtt ccattgccta cagcctcctg agtgccagct cagagcagga caacccgtcc accagtggct gcagcagtga acagtcagcc cgggcaagga ctcagaagga actcatgaca gcacttcgag agctcaagct tcgactgccg ccagagcgcc ggggcaaggg ccgctctggg accctggcca cgctgcagta cgcactggcc tgtgtcaagc aggtgcaggc caaccaggaa tactaccagc agtggagcct ggaggagggc gagccttgct ccatggacat gtccacctat accctggagg agctggagca catcacgtct gagtacacac ttcagaacca ggataccttc tcagtggctg tctccttcct gacgggccga atcgtctaca tttcggagca ggcagccgtc ctgctgcgtt gcaagcggga cgtgttccgg ggtacccgct tctctgagct cctggctccc caggatgtgg gagtcttcta tggttccact gctccatctc gcctgcccac ctggggcaca ggggcctcag caggttcagg cctcagggac tttacccagg agaagtccgt cttctgccgt atcagaggag gtcctgaccg ggatccaggg cctcggtacc agccattccg cctaaccccg tatgtgacca agatccgggt ctcagatggg gcccctgcac agccgtgctg cctgctgatt gcagagcgca tccattcggg ttacgaagct ccccggatac cccctgacaa gaggattttc actacgcggc acacacccag ctgcctcttc caggatgtgg atgaaagggc tgcccccctg ctgggctacc tgccccagga cctcctgggg gccccagtgc tcctgttcct gcatcctgag gaccgacccc tcatgctggc tatccacaag aagattctgc agttggcggg ccagcccttt gaccactccc ctatccgctt ctgtgcccgc aacggggagt atgtcaccat ggacaccagc tgggctggct ttgtgcaccc ctggagccgc aaggtagcct tcgtgttggg ccgccacaaa gtacgcacgg cccccctgaa tgaggacgtg ttcactcccc cggcccccag cccagctccc tccctggaca ctgatatcca ggagctgtca gagcagatcc accggctgct gctgcagccc gtccacagcc ccagccccac gggactctgt ggagtcggcg ccgtgacatc cccaggccct ctccacagcc ctgggtcctc cagtgatagc aacgggggtg atgcagaggg gcctgggcct cctgcgccac tacaggcacg ttcaaggcca aggcccttcc ctgccaatcc ccagacccag agctggaggc gggttctgct cccgtccagg ccccactag. It is sometimes possible for the material contained within the vial of "PER1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.