Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PEBP1 cdna clone

PEBP1 cDNA Clone

Gene Names
PEBP1; PBP; HCNP; PEBP; RKIP; HCNPpp; PEBP-1; HEL-210; HEL-S-34; HEL-S-96
Synonyms
PEBP1; PEBP1 cDNA Clone; PEBP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggtggacctcagcaagtggtccgggcccttgagcctgcaagaagtggacgagcagccgcagcacccactgcatgtcacctacgccggggcggcggtggacgagctgggcaaagtgctgacgcccacccaggttaagaatagacccaccagcatttcgtgggatggtcttgattcagggaagctctacaccttggtcctgacagacccggatgctcccagcaggaaggatcccaaatacagagaatggcatcatttcctggtggtcaacatgaagggcaatgacatcagcagtggcacagtcctctccgattatgtgggctcggggcctcccaagggcacaggcctccaccgctatgtctggctggtttacgagcaggacaggccgctaaagtgtgacgagcccatcctcagcaaccgatctggagaccaccgtggcaaattcaaggtggcgtccttccgtaaaaagtatgagctcagggccccggtggctggcacgtgttaccaggccgagtgggatgactatgtgcccaaactgtacgagcagctgtctgggaagtag
Sequence Length
564
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,057 Da
NCBI Official Full Name
Homo sapiens phosphatidylethanolamine binding protein 1, mRNA
NCBI Official Synonym Full Names
phosphatidylethanolamine binding protein 1
NCBI Official Symbol
PEBP1
NCBI Official Synonym Symbols
PBP; HCNP; PEBP; RKIP; HCNPpp; PEBP-1; HEL-210; HEL-S-34; HEL-S-96
NCBI Protein Information
phosphatidylethanolamine-binding protein 1
UniProt Protein Name
Phosphatidylethanolamine-binding protein 1
UniProt Gene Name
PEBP1
UniProt Synonym Gene Names
PBP; PEBP; PEBP-1; RKIP; HCNP
UniProt Entry Name
PEBP1_HUMAN

NCBI Description

This gene encodes a member of the phosphatidylethanolamine-binding family of proteins and has been shown to modulate multiple signaling pathways, including the MAP kinase (MAPK), NF-kappa B, and glycogen synthase kinase-3 (GSK-3) signaling pathways. The encoded protein can be further processed to form a smaller cleavage product, hippocampal cholinergic neurostimulating peptide (HCNP), which may be involved in neural development. This gene has been implicated in numerous human cancers and may act as a metastasis suppressor gene. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Jul 2015]

Uniprot Description

RKIP: a metastasis suppressor that regulates extracellular matrix remodeling and tumor survival. Binds to and inhibits Raf-1. Phosphorylation by classic and atypical but not novel PKC isoforms dissociates this complex, relieving inhibition of the Raf/MAP kinase signaling cascade. Binds ATP, opioids and phosphatidylethanolamine. Has lower affinity for phosphatidylinositol and phosphatidylcholine. Serine protease inhibitor which inhibits thrombin, neuropsin and chymotrypsin but not trypsin, tissue type plasminogen activator and elastase Inhibits the kinase activity of RAF1 by inhibiting its activation and by dissociating the RAF1/MEK complex and acting as a competitive inhibitor of MEK phosphorylation. Cleaved into hippocampal cholinergic neurostimulating peptide (HCMP) that appears to be involved in the function of the presynaptic cholinergic neurons of the central nervous system. HCNP increases the production of choline acetyltransferase but not acetylcholinesterase. Expressed in brain. Increased expression in aged senescence-accelerated mice.

Protein type: Lipid-binding; Protein kinase, regulatory subunit

Chromosomal Location of Human Ortholog: 12q24.23

Cellular Component: cytosol; nucleus

Molecular Function: enzyme binding; phosphatidylethanolamine binding; protein binding; protein kinase binding

Biological Process: MAPKKK cascade

Research Articles on PEBP1

Similar Products

Product Notes

The PEBP1 pebp1 (Catalog #AAA1270233) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggtgg acctcagcaa gtggtccggg cccttgagcc tgcaagaagt ggacgagcag ccgcagcacc cactgcatgt cacctacgcc ggggcggcgg tggacgagct gggcaaagtg ctgacgccca cccaggttaa gaatagaccc accagcattt cgtgggatgg tcttgattca gggaagctct acaccttggt cctgacagac ccggatgctc ccagcaggaa ggatcccaaa tacagagaat ggcatcattt cctggtggtc aacatgaagg gcaatgacat cagcagtggc acagtcctct ccgattatgt gggctcgggg cctcccaagg gcacaggcct ccaccgctat gtctggctgg tttacgagca ggacaggccg ctaaagtgtg acgagcccat cctcagcaac cgatctggag accaccgtgg caaattcaag gtggcgtcct tccgtaaaaa gtatgagctc agggccccgg tggctggcac gtgttaccag gccgagtggg atgactatgt gcccaaactg tacgagcagc tgtctgggaa gtag. It is sometimes possible for the material contained within the vial of "PEBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.