PDS5A cdna clone
PDS5A cDNA Clone
Gene Names
PDS5A; PIG54; SCC112; SCC-112
Synonyms
PDS5A; PDS5A cDNA Clone; PDS5A cdna clone
Sequence
atggacttcaccgcgcagcccaagcctgccactgccctctgtggcgtcgtgagtgccgacgggaagatcgcttaccctccgggggtaaaagagatcaccgacaagatcaccacggacgagatgatcaaacgcctgaagatggtagtgaaaacctttatggatatggatcaggactcagaagatgaaaaacagcagtatctcccactagccttgcatcttgcatctgaattcttcctcaggaaccccaataaagatgtgcgtctccttgtagcatgttgtttggctgatatctttcgtatctatgccccagaagctccatatacttcccatgataaacttaaggacatatttttgtttattaccagacaattaaaaggtttggaggatacaaagagtccacagtttaatagatacttttatttattagagaatttagcttgggttaaatcatataacatctgctttgaattggaagattgcaatgaaatttttattcagctttttagaactctcttctcagtgatcaacaatagccacaataagaaggtacaaatgcacatgctagatttgatgagttctatcatcatggaaggtgatggagttactcaagaattattggactccattcttattaacctcattcctgcacataagaacttaaataaacagtcctttgaccttgcaaaagtgctattgaaaagaacagtccagactattgaggcatgcattgctaattttttcaatcaagtcctggtgctgggaagatcatcagtaagtgatttgtcagaacatgtatttgatctgattcaggaactttttgctatagatcctcatttattattatccgtcatgccacagcttgaattcaaactaaagagcaatgatggagaagagcgattagctgttgttcgacttctagctaaattgtttggctccaaagattctgatttggcaacacagaatcgtcctctttggcaatgttttcttggacgatttaatgatattcatgttcctgtgagattagaaagtgtgaaatttgccagtcattgtttaatgaatcacccagatttagcgaaggatctcacagaatatttaaaggttagatcacatgatccagaagaagctattcgtcatgatgtcattgttactataataacagctgccaagagggacctggccttagtaaatgatcagctgcttggctttgtaagggaaagaacactggataaacggtggcgagtaagaaaagaagctatgatgggtctggctcagctttataagaaatactgtcttcatggtgaagcaggaaaggaagctgcagagaaagtcagctggataaaggacaaacttctgcatatttattatcagaacagcattgacgacaaactgttggtagagaaaatctttgctcagtatcttgtcccccacaacctggaaacagaagagagaatgaaatgcttatattacttatatgctagtttggatccaaatgctgtaaaagctctcaacgaaatgtggaagtgtcagaacatgcttcggagccatgtacgcgaactattggatttgcacaagcagcctacatcagaggctaactgttctgccatgtttggaaaactgatgaccatagcaaagaatttgcctgaccccgggaaagcacaagattttgtgaagaaatttaaccaggttctcggcgatgatgagaaacttcggtctcagttggagttattaattagcccaacctgttcttgcaaacaagcagatatttgtgtggttagtaaatcatacttcacactttttctctag
Sequence Length
1803
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,000 Da
NCBI Official Full Name
Homo sapiens PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
PDS5 cohesin associated factor A
NCBI Official Symbol
PDS5A
NCBI Official Synonym Symbols
PIG54; SCC112; SCC-112
NCBI Protein Information
sister chromatid cohesion protein PDS5 homolog A
UniProt Protein Name
Sister chromatid cohesion protein PDS5 homolog A
Protein Family
UniProt Gene Name
PDS5A
UniProt Synonym Gene Names
SCC-112
UniProt Entry Name
PDS5A_HUMAN
NCBI Description
The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Uniprot Description
SCC-112: a cell-cycle regulated protein.
Protein type: Cell cycle regulation
Chromosomal Location of Human Ortholog: 4p14
Cellular Component: chromatin; chromosome; chromosome, pericentric region; cytosol; nucleoplasm; plasma membrane
Molecular Function: protein binding
Biological Process: mitotic sister chromatid cohesion; negative regulation of DNA replication; sister chromatid cohesion
Research Articles on PDS5A
Similar Products
Product Notes
The PDS5A pds5a (Catalog #AAA1276718) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacttca ccgcgcagcc caagcctgcc actgccctct gtggcgtcgt gagtgccgac gggaagatcg cttaccctcc gggggtaaaa gagatcaccg acaagatcac cacggacgag atgatcaaac gcctgaagat ggtagtgaaa acctttatgg atatggatca ggactcagaa gatgaaaaac agcagtatct cccactagcc ttgcatcttg catctgaatt cttcctcagg aaccccaata aagatgtgcg tctccttgta gcatgttgtt tggctgatat ctttcgtatc tatgccccag aagctccata tacttcccat gataaactta aggacatatt tttgtttatt accagacaat taaaaggttt ggaggataca aagagtccac agtttaatag atacttttat ttattagaga atttagcttg ggttaaatca tataacatct gctttgaatt ggaagattgc aatgaaattt ttattcagct ttttagaact ctcttctcag tgatcaacaa tagccacaat aagaaggtac aaatgcacat gctagatttg atgagttcta tcatcatgga aggtgatgga gttactcaag aattattgga ctccattctt attaacctca ttcctgcaca taagaactta aataaacagt cctttgacct tgcaaaagtg ctattgaaaa gaacagtcca gactattgag gcatgcattg ctaatttttt caatcaagtc ctggtgctgg gaagatcatc agtaagtgat ttgtcagaac atgtatttga tctgattcag gaactttttg ctatagatcc tcatttatta ttatccgtca tgccacagct tgaattcaaa ctaaagagca atgatggaga agagcgatta gctgttgttc gacttctagc taaattgttt ggctccaaag attctgattt ggcaacacag aatcgtcctc tttggcaatg ttttcttgga cgatttaatg atattcatgt tcctgtgaga ttagaaagtg tgaaatttgc cagtcattgt ttaatgaatc acccagattt agcgaaggat ctcacagaat atttaaaggt tagatcacat gatccagaag aagctattcg tcatgatgtc attgttacta taataacagc tgccaagagg gacctggcct tagtaaatga tcagctgctt ggctttgtaa gggaaagaac actggataaa cggtggcgag taagaaaaga agctatgatg ggtctggctc agctttataa gaaatactgt cttcatggtg aagcaggaaa ggaagctgca gagaaagtca gctggataaa ggacaaactt ctgcatattt attatcagaa cagcattgac gacaaactgt tggtagagaa aatctttgct cagtatcttg tcccccacaa cctggaaaca gaagagagaa tgaaatgctt atattactta tatgctagtt tggatccaaa tgctgtaaaa gctctcaacg aaatgtggaa gtgtcagaac atgcttcgga gccatgtacg cgaactattg gatttgcaca agcagcctac atcagaggct aactgttctg ccatgtttgg aaaactgatg accatagcaa agaatttgcc tgaccccggg aaagcacaag attttgtgaa gaaatttaac caggttctcg gcgatgatga gaaacttcgg tctcagttgg agttattaat tagcccaacc tgttcttgca aacaagcaga tatttgtgtg gttagtaaat catacttcac actttttctc tag. It is sometimes possible for the material contained within the vial of "PDS5A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
