Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDLIM5 cdna clone

PDLIM5 cDNA Clone

Gene Names
PDLIM5; L9; ENH; LIM; ENH1
Synonyms
PDLIM5; PDLIM5 cDNA Clone; PDLIM5 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaactacagtgtgtcactggttggcccagctccttggggtttccggctgcagggcggtaaggatttcaacatgcctctgacaatctctagtctaaaagatggcggcaaggcagcccaggcaaatgtaagaataggcgatgtggttctcagcattgatggaataaatgcacaaggaatgactcatcttgaagcccagaataagattaagggttgtacaggctctttgaatatgactctgcaaagagcatctgctgcacccaagcctgagccggttcctgttcaaaagaaaacacaagtgacaaataaccctggcactgtgaaaatcccacctaaacgcccaccaagaaaacacattgtggagcgctatacagagttttatcatgtacccactcacagtgatgccagcaagaagagactgattgaggatactgaagactggcgtccaaggactggaacaactcaatctcgctctttccgaatccttgcccagatcactgggactgaacatttgaaagaatctgaagccgataatacaaagaaggcaaaggaaaagataccccttcacgtctttagtcccaaatacacaaaattacgtgactggcaccatgaagtttcagcacgtgctcttaacgtacagtga
Sequence Length
645
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,645 Da
NCBI Official Full Name
Homo sapiens PDZ and LIM domain 5, mRNA
NCBI Official Synonym Full Names
PDZ and LIM domain 5
NCBI Official Symbol
PDLIM5
NCBI Official Synonym Symbols
L9; ENH; LIM; ENH1
NCBI Protein Information
PDZ and LIM domain protein 5
UniProt Protein Name
PDZ and LIM domain protein 5
UniProt Gene Name
PDLIM5
UniProt Synonym Gene Names
ENH
UniProt Entry Name
PDLI5_HUMAN

NCBI Description

This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]

Uniprot Description

LIM: an adaptor protein of the Enigma family. Contains three LIM domains and one PDZ domain. LIM domains are cysteine-rich double zinc fingers composed of 50 to 60 amino acids that are involved in protein-protein interactions. LIM domain-containing proteins are scaffolds for the formation of multiprotein complexes. The proteins are involved in cytoskeleton organization, cell lineage specification, organ development, and oncogenesis. Enigma family proteins possess a 100-amino acid PDZ domain in the N terminus and 1 to 3 LIM domains in the C terminus.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 4q22

Cellular Component: actin cytoskeleton; cell-cell adherens junction; cytosol; membrane; postsynaptic density

Molecular Function: actin binding; actinin binding; protein binding; protein kinase C binding

Biological Process: regulation of synaptogenesis

Research Articles on PDLIM5

Similar Products

Product Notes

The PDLIM5 pdlim5 (Catalog #AAA1270134) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaact acagtgtgtc actggttggc ccagctcctt ggggtttccg gctgcagggc ggtaaggatt tcaacatgcc tctgacaatc tctagtctaa aagatggcgg caaggcagcc caggcaaatg taagaatagg cgatgtggtt ctcagcattg atggaataaa tgcacaagga atgactcatc ttgaagccca gaataagatt aagggttgta caggctcttt gaatatgact ctgcaaagag catctgctgc acccaagcct gagccggttc ctgttcaaaa gaaaacacaa gtgacaaata accctggcac tgtgaaaatc ccacctaaac gcccaccaag aaaacacatt gtggagcgct atacagagtt ttatcatgta cccactcaca gtgatgccag caagaagaga ctgattgagg atactgaaga ctggcgtcca aggactggaa caactcaatc tcgctctttc cgaatccttg cccagatcac tgggactgaa catttgaaag aatctgaagc cgataataca aagaaggcaa aggaaaagat accccttcac gtctttagtc ccaaatacac aaaattacgt gactggcacc atgaagtttc agcacgtgct cttaacgtac agtga. It is sometimes possible for the material contained within the vial of "PDLIM5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.