Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDLIM1 cdna clone

PDLIM1 cDNA Clone

Gene Names
PDLIM1; CLIM1; CLP36; CLP-36; hCLIM1; HEL-S-112
Synonyms
PDLIM1; PDLIM1 cDNA Clone; PDLIM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccacccagcagatagacctccagggcccggggccgtggggcttccgcctcgtgggcggcaaggacttcgagcagcctctcgccatttcccgggtcactcctggaagcaaggcggctctagctaatttatgtattggagatgtaatcacagccattgatggggaaaatactagcaatatgacacacttggaagctcagaacagaatcaaaggctgcacagacaacttgactctcactgtagccagatctgaacataaagtctggtctcctctggtgacggaggaagggaagcgtcatccatacaagatgaatttagcctctgaaccccaggaggtcctgcacataggaagcgcccacaaccgaagtgccatgccctttaccgcctcgcctgcctccagcactactgccagggtcatcacaaaccagtacaacaacccagctggcctctactcttctgaaaatatctccaacttcaacaatgccctggagtcaaagactgctgccagcggggtggaggcgaacagcagacccttagaccatgctcagcctccaagcagccttgtcatcgacaaagaatctgaagtttacaagatgcttcaggagaaacaggagttgaatgagcccccgaaacagtccacgtctttcttggttttgcaggaaatcctggagtctgaagaaaaaggggatcccaacaagccctcaggattcagaagtgttaaagctcctgtcactaaagtggctgcgtcgattggaaatgctcagaagttgcctatgtgtgacaaatgtggcactgggattgttggtgtgtttgtgaagctgcgggaccgtcaccgccaccctgagtgttatgtgtgcactgactgtggcaccaacctgaaacagaagggccatttctttgtggaggatcaaatctactgtgagaagcatgcccgggagcgagtcacaccacctgagggttatgaagtggtcactgtgttccccaagtga
Sequence Length
990
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,072 Da
NCBI Official Full Name
Homo sapiens PDZ and LIM domain 1, mRNA
NCBI Official Synonym Full Names
PDZ and LIM domain 1
NCBI Official Symbol
PDLIM1
NCBI Official Synonym Symbols
CLIM1; CLP36; CLP-36; hCLIM1; HEL-S-112
NCBI Protein Information
PDZ and LIM domain protein 1
UniProt Protein Name
PDZ and LIM domain protein 1
UniProt Gene Name
PDLIM1
UniProt Synonym Gene Names
CLIM1; CLP36
UniProt Entry Name
PDLI1_HUMAN

NCBI Description

This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]

Uniprot Description

CLIM1: a cytoskeletal adaptor protein that bring other proteins to the cytoskeleton. Interacts with alpha-actinins 1, 2 and 4. Recruits the Clik1 kinase to actin stress fibers in nonmuscle cells. Strongly expressed in the heart and skeletal muscle, moderately expressed in the spleen, small intestine, colon, placenta, and lung. A lower level expression is seen in liver, thymus, kidney, prostate and pancreas and is not found in the brain, testis, ovary, and peripheral blood leukocytes.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 10q23.1

Cellular Component: cell-cell adherens junction; focal adhesion

Biological Process: response to oxidative stress

Research Articles on PDLIM1

Similar Products

Product Notes

The PDLIM1 pdlim1 (Catalog #AAA1273713) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccaccc agcagataga cctccagggc ccggggccgt ggggcttccg cctcgtgggc ggcaaggact tcgagcagcc tctcgccatt tcccgggtca ctcctggaag caaggcggct ctagctaatt tatgtattgg agatgtaatc acagccattg atggggaaaa tactagcaat atgacacact tggaagctca gaacagaatc aaaggctgca cagacaactt gactctcact gtagccagat ctgaacataa agtctggtct cctctggtga cggaggaagg gaagcgtcat ccatacaaga tgaatttagc ctctgaaccc caggaggtcc tgcacatagg aagcgcccac aaccgaagtg ccatgccctt taccgcctcg cctgcctcca gcactactgc cagggtcatc acaaaccagt acaacaaccc agctggcctc tactcttctg aaaatatctc caacttcaac aatgccctgg agtcaaagac tgctgccagc ggggtggagg cgaacagcag acccttagac catgctcagc ctccaagcag ccttgtcatc gacaaagaat ctgaagttta caagatgctt caggagaaac aggagttgaa tgagcccccg aaacagtcca cgtctttctt ggttttgcag gaaatcctgg agtctgaaga aaaaggggat cccaacaagc cctcaggatt cagaagtgtt aaagctcctg tcactaaagt ggctgcgtcg attggaaatg ctcagaagtt gcctatgtgt gacaaatgtg gcactgggat tgttggtgtg tttgtgaagc tgcgggaccg tcaccgccac cctgagtgtt atgtgtgcac tgactgtggc accaacctga aacagaaggg ccatttcttt gtggaggatc aaatctactg tgagaagcat gcccgggagc gagtcacacc acctgagggt tatgaagtgg tcactgtgtt ccccaagtga. It is sometimes possible for the material contained within the vial of "PDLIM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.