Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDK2 cdna clone

PDK2 cDNA Clone

Gene Names
PDK2; PDHK2; PDKII
Synonyms
PDK2; PDK2 cDNA Clone; PDK2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgctgggtgtgggcgctgctgaagaatgcgtccctggcaggggcgcccaagtacatagagcacttcagcaagttctccccgtccccgctgtccatgaagcagtttctggacttcggatccagcaatgcctgtgagaaaacctccttcaccttcctcaggcaggagctgcctgtgcgcctggccaacatcatgaaagagatcaacctgcttcccgaccgagtgctgagcacaccctccgtgcagctggtgcagagctggtatgtccagagcctcctggacatcatggagttcctggacaaggatcccgaggaccatcgcaccctgagccagttcactgacgccctggtcaccatccggaaccggcacaacgacgtggtgcccaccatggcacaaggcgtgcttgagtacaaggacacctacggcgatgaccccgtctccaaccagaacatccagtacttcctggaccgcttctacctcagccgcatctccatccgcatgctcatcaaccagcacaccctcatctttgatggcagcaccaacccagcccatcccaaacacatcggcagcatcgaccccaactgcaacgtctctgaggtggtcaaagatgcctacgacatggctaagctcctgtgtgacaagtattacatggcctcacctgacctggagatccaggagatcaatgcagccaactccaaacagccgattcacatggtctacgtcccctcccacctctaccacatgctctttgagctcttcaagaatgccatgagggcgactgtggaaagccatgagtccagcctcattctcccacccatcaaggtcatggtggccttgggtgaggaagatctgtccatcaagatgagtgaccgaggtgggggtgttcccttgaggaagattgagcgactcttcagctacatgtactccacagcacccaccccccagcctggcaccgggggaacgccgctggctggctttggttatgggctccccatttcccgcctctacgccaagtacttccagggagacctgcagctcttctccatggaaggctttgggaccgatgctgtcatctatctcaaggccctgtccacggactcggtggagcgcctgcctgtctacaacaagtcagcctggcgccactaccagaccatccaggaggccggcgactggtgtgtgcccagcacggagcccaagaacacgtccacgtaccgcgtcagctaa
Sequence Length
1224
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,864 Da
NCBI Official Full Name
Homo sapiens pyruvate dehydrogenase kinase, isozyme 2, mRNA
NCBI Official Synonym Full Names
pyruvate dehydrogenase kinase 2
NCBI Official Symbol
PDK2
NCBI Official Synonym Symbols
PDHK2; PDKII
NCBI Protein Information
pyruvate dehydrogenase kinase, isozyme 2
UniProt Protein Name
[Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 2, mitochondrial
UniProt Gene Name
PDK2
UniProt Synonym Gene Names
PDHK2; PDH kinase 2; PDKII
UniProt Entry Name
PDK2_HUMAN

NCBI Description

This gene encodes a member of the pyruvate dehydrogenase kinase family. The encoded protein phosphorylates pyruvate dehydrogenase, down-regulating the activity of the mitochondrial pyruvate dehydrogenase complex. Overexpression of this gene may play a role in both cancer and diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

Uniprot Description

PDHK2: an atypical protein kinase associated with the mitochondrial matrix. The PDHKs play crucial roles in switching metabolic flux from oxidative phosphorylation towards glycolysis. PDHK2 is expressed in all tissues. Contains a HATPase_c catalytic domain, found in several ATP-binding proteins including protein histidine kinases (PHKs), PHDKs, DNA gyrase B, topoisomerases, heat shock proteins, and DNA mismatch repair proteins. PDHK regulates glucose oxidation through inhibitory phosphorylation of the E1 alpha subunit of the mitochondrial pyruvate dehydrogenase complex (PDHC) at any one of 3 inhibitory serine residues. Inhibitory sites 1, 2, and 3 correspond to S293, S300, and S232 in human PDHA1, respectively. Four PDHK isoenzymes have been described, each with different site specificity: all four phosphorylate sites 1 and 2 but at different rates; for site 1 PDHK2 >PDHK4 >PDHK1 >PDHK3; for site 2, PDHK3> PDHK4 > PDHK2 > PDHK1. Only PDHK1 phosphorylates site 3. PDHKs are recruited to the PDHC by binding to a lipoyl group covalently attached to the inner lipoyl domain of the E2 component. PDHA1 deficiency is the most common enzyme defect in patients with primary lactic acidosis. Suppression of PDH by PDHK inhibits the conversion of pyruvate to acetyl-CoA, attenuates mitochondrial respiration, and may contribute to the increased lactate production observed in many tumors. The PDH pathway is repressed in a majority of non-small cell lung carcinomas. Inhibited by AZD7545, dichloroacetate (DCA), and radicicol. Radicicol inhibits kinase activity by binding directly to the ATP-binding pocket of PDHK, similar to HSP90 from the same ATPase/kinase superfamily.

Protein type: Protein kinase, atypical; Kinase, protein; EC 2.7.11.2; Mitochondrial; ATYPICAL group; PDHK family; PDHK subfamily

Chromosomal Location of Human Ortholog: 17q21.33

Cellular Component: cytoplasm; mitochondrial matrix; mitochondrial pyruvate dehydrogenase complex; mitochondrion; nucleoplasm

Molecular Function: ATP binding; protein homodimerization activity; protein kinase activity; pyruvate dehydrogenase (acetyl-transferring) kinase activity

Biological Process: cellular response to nutrient; glucose homeostasis; insulin receptor signaling pathway; regulation of acetyl-CoA biosynthetic process from pyruvate; regulation of gluconeogenesis; regulation of pH

Research Articles on PDK2

Similar Products

Product Notes

The PDK2 pdk2 (Catalog #AAA1276752) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgctggg tgtgggcgct gctgaagaat gcgtccctgg caggggcgcc caagtacata gagcacttca gcaagttctc cccgtccccg ctgtccatga agcagtttct ggacttcgga tccagcaatg cctgtgagaa aacctccttc accttcctca ggcaggagct gcctgtgcgc ctggccaaca tcatgaaaga gatcaacctg cttcccgacc gagtgctgag cacaccctcc gtgcagctgg tgcagagctg gtatgtccag agcctcctgg acatcatgga gttcctggac aaggatcccg aggaccatcg caccctgagc cagttcactg acgccctggt caccatccgg aaccggcaca acgacgtggt gcccaccatg gcacaaggcg tgcttgagta caaggacacc tacggcgatg accccgtctc caaccagaac atccagtact tcctggaccg cttctacctc agccgcatct ccatccgcat gctcatcaac cagcacaccc tcatctttga tggcagcacc aacccagccc atcccaaaca catcggcagc atcgacccca actgcaacgt ctctgaggtg gtcaaagatg cctacgacat ggctaagctc ctgtgtgaca agtattacat ggcctcacct gacctggaga tccaggagat caatgcagcc aactccaaac agccgattca catggtctac gtcccctccc acctctacca catgctcttt gagctcttca agaatgccat gagggcgact gtggaaagcc atgagtccag cctcattctc ccacccatca aggtcatggt ggccttgggt gaggaagatc tgtccatcaa gatgagtgac cgaggtgggg gtgttccctt gaggaagatt gagcgactct tcagctacat gtactccaca gcacccaccc cccagcctgg caccggggga acgccgctgg ctggctttgg ttatgggctc cccatttccc gcctctacgc caagtacttc cagggagacc tgcagctctt ctccatggaa ggctttggga ccgatgctgt catctatctc aaggccctgt ccacggactc ggtggagcgc ctgcctgtct acaacaagtc agcctggcgc cactaccaga ccatccagga ggccggcgac tggtgtgtgc ccagcacgga gcccaagaac acgtccacgt accgcgtcag ctaa. It is sometimes possible for the material contained within the vial of "PDK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.