Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDHA1 cdna clone

PDHA1 cDNA Clone

Gene Names
PDHA1; PDHA; PDHAD; PHE1A; PDHCE1A
Synonyms
PDHA1; PDHA1 cDNA Clone; PDHA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggaagatgctcgccgccgtctcccgcgtgctgtctggcgcttctcagaagccggcaagcagagtgctggtagcatcccgtaattttgcaaatgatgctacatttgaaattaagaaatgtgaccttcaccggctggaagaaggccctcctgtcacaacagtgctcaccagggaggatgggctcaaatactacaggatgatgcagactgtacgccgaatggagttgaaagcagatcagctgtataaacagaaaattattcgtggtttctgtcacttgtgtgatggtcaggaagcttgctgtgtgggcctggaggccggcatcaaccccacagaccatctcatcacagcctaccgggctcacggctttactttcacccggggcctttccgtccgagaaattctcgcagagcttacaggacgaaaaggaggttgtgctaaagggaaaggaggatcgatgcacatgtatgccaagaacttctacgggggcaatggcatcgtgggagcgcaggtgcccctgggcgctgggattgctctagcctgtaagtataatggaaaagatgaggtctgcctgactttatatggcgatggtgctgctaaccagggccagatattcgaagcttacaacatggcagctttgtggaaattaccttgtattttcatctgtgagaataatcgctatggaatgggaacgtctgttgagagagcggcagccagcactgattactacaagagaggcgatttcattcctgggctgagagtggatggaatggatatcctgtgcgtccgagaggcaacaaggtttgctgctgcctattgtagatctgggaaggggcccatcctgatggagctgcagacttaccgttaccacggacacagtatgagtgaccctggagtcagttaccgtacacgagaagaaattcaggaagtaagaagtaagagtgaccctattatgcttctcaaggacaggatggtgaacagcaatcttgccagtgtggaagaactaaaggaaattgatgtggaagtgaggaaggagattgaggatgctgcccagtttgccacggccgatcctgagccacctttggaagagctgggctaccacatctactccagcgacccaccttttgaagttcgtggtgccaatcagtggatcaagtttaagtcagtcagttaa
Sequence Length
1173
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,580 Da
NCBI Official Full Name
Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1, mRNA
NCBI Official Synonym Full Names
pyruvate dehydrogenase (lipoamide) alpha 1
NCBI Official Symbol
PDHA1
NCBI Official Synonym Symbols
PDHA; PDHAD; PHE1A; PDHCE1A
NCBI Protein Information
pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial
UniProt Protein Name
Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial
UniProt Gene Name
PDHA1
UniProt Synonym Gene Names
PHE1A
UniProt Entry Name
ODPA_HUMAN

NCBI Description

The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]

Uniprot Description

PDHA1: a mitochondrial matrix enzyme that catalyzes the oxidative decarboxylation of pyruvate, producing acetyl-CoA and CO2. A key enzyme in controlling the balance between lipid and glucose oxidation depending on substrate availability. The pyruvate dehydrogenase (PDH) holoenzyme is a multi-enzyme complex (PDHC) that contains 20-30 copies of pyruvate decarboxylase tetramers (2 alpha:2 beta)(E1), 60 copies of dihydrolipoamide acetyltransferase (E2), six homodimers of dihydrolipoamide dehydrogenase (E3), plus E3 binding proteins. The activity of PDH is tightly regulated by phosphorylation. The phosphorylation of at least one of three specific serine residues in E1 subunit by PDHK inactivates the PDHC, while dephosphorylation by PDP restores its activity. Sites 1, 2, and 3 of PDHA1 are S293, S300, and S232, respectively. Four PDHK isoenzymes have been described, each with different site specificity: all four phosphorylate sites 1 and 2 but at different rates; for site 1 PDHK2 >PDHK4 >PDHK1 >PDHK3; for site 2, PDHK3> PDHK4 > PDHK2 > PDHK1. Only PDHK1 phosphorylates site 3. PDHA1 deficiency is the most common enzyme defect in patients with primary lactic acidosis.

Protein type: Carbohydrate Metabolism - pyruvate; Carbohydrate Metabolism - butanoate; Amino Acid Metabolism - valine, leucine and isoleucine biosynthesis; EC 1.2.4.1; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Oxidoreductase; Mitochondrial; Carbohydrate Metabolism - citrate (TCA) cycle

Chromosomal Location of Human Ortholog: Xp22.1

Cellular Component: mitochondrial matrix; mitochondrion; nucleus; pyruvate dehydrogenase complex

Molecular Function: pyruvate dehydrogenase activity

Biological Process: acetyl-CoA biosynthetic process from pyruvate; glyoxylate metabolic process; pyruvate metabolic process; regulation of acetyl-CoA biosynthetic process from pyruvate; tricarboxylic acid cycle

Disease: Pyruvate Dehydrogenase E1-alpha Deficiency

Research Articles on PDHA1

Similar Products

Product Notes

The PDHA1 pdha1 (Catalog #AAA1266331) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggaaga tgctcgccgc cgtctcccgc gtgctgtctg gcgcttctca gaagccggca agcagagtgc tggtagcatc ccgtaatttt gcaaatgatg ctacatttga aattaagaaa tgtgaccttc accggctgga agaaggccct cctgtcacaa cagtgctcac cagggaggat gggctcaaat actacaggat gatgcagact gtacgccgaa tggagttgaa agcagatcag ctgtataaac agaaaattat tcgtggtttc tgtcacttgt gtgatggtca ggaagcttgc tgtgtgggcc tggaggccgg catcaacccc acagaccatc tcatcacagc ctaccgggct cacggcttta ctttcacccg gggcctttcc gtccgagaaa ttctcgcaga gcttacagga cgaaaaggag gttgtgctaa agggaaagga ggatcgatgc acatgtatgc caagaacttc tacgggggca atggcatcgt gggagcgcag gtgcccctgg gcgctgggat tgctctagcc tgtaagtata atggaaaaga tgaggtctgc ctgactttat atggcgatgg tgctgctaac cagggccaga tattcgaagc ttacaacatg gcagctttgt ggaaattacc ttgtattttc atctgtgaga ataatcgcta tggaatggga acgtctgttg agagagcggc agccagcact gattactaca agagaggcga tttcattcct gggctgagag tggatggaat ggatatcctg tgcgtccgag aggcaacaag gtttgctgct gcctattgta gatctgggaa ggggcccatc ctgatggagc tgcagactta ccgttaccac ggacacagta tgagtgaccc tggagtcagt taccgtacac gagaagaaat tcaggaagta agaagtaaga gtgaccctat tatgcttctc aaggacagga tggtgaacag caatcttgcc agtgtggaag aactaaagga aattgatgtg gaagtgagga aggagattga ggatgctgcc cagtttgcca cggccgatcc tgagccacct ttggaagagc tgggctacca catctactcc agcgacccac cttttgaagt tcgtggtgcc aatcagtgga tcaagtttaa gtcagtcagt taa. It is sometimes possible for the material contained within the vial of "PDHA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.