Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDGFB cdna clone

PDGFB cDNA Clone

Gene Names
PDGFB; SIS; SSV; IBGC5; PDGF2; c-sis; PDGF-2
Synonyms
PDGFB; PDGFB cDNA Clone; PDGFB cdna clone
Ordering
For Research Use Only!
Sequence
atgaatcgctgctgggcgctcttcctgtctctctgctgctacctgcgtctggtcagcgccgagggggaccccattcccgaggagctttatgagatgctgagtgaccactcgatccgctcctttgatgatctccaacgcctgctgcacggagaccccggagaggaagatggggccgagttggacctgaacatgacccgctcccactctggaggcgagctggagagcttggctcgtggaagaaggagcctgggttccctgaccattgctgagccggccatgatcgccgagtgcaagacgcgcaccgaggtgttcgagatctcccggcgcctcatagaccgcaccaacgccaacttcctggtgtggccgccctgtgtggaggtgcagcgctgctccggctgctgcaacaaccgcaacgtgcagtgccgccccacccaggtgcagctgcgacctgtccaggtgagaaagatcgagattgtgcggaagaagccaatctttaagaaggccacggtgacgctggaagaccacctggcatgcaagtgtgagacagtggcagctgcacggcctgtgacccgaagcccggggggttcccaggagcagcgagccaaaacgccccaaactcgggtgaccattcggacggtgcgagtccgccggccccccaagggcaagcaccggaaattcaagcacacgcatgacaagacggcactgaaggagacccttggagcctag
Sequence Length
726
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,502 Da
NCBI Official Full Name
Homo sapiens platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog), mRNA
NCBI Official Synonym Full Names
platelet derived growth factor subunit B
NCBI Official Symbol
PDGFB
NCBI Official Synonym Symbols
SIS; SSV; IBGC5; PDGF2; c-sis; PDGF-2
NCBI Protein Information
platelet-derived growth factor subunit B
UniProt Protein Name
Platelet-derived growth factor subunit B
UniProt Gene Name
PDGFB
UniProt Synonym Gene Names
PDGF2; SIS; PDGF subunit B
UniProt Entry Name
PDGFB_HUMAN

NCBI Description

This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit B, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit A. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with dermatofibrosarcoma protuberans, a rare skin tumor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]

Uniprot Description

PDGFB: Growth factor that plays an essential role in the regulation of embryonic development, cell proliferation, cell migration, survival and chemotaxis. Potent mitogen for cells of mesenchymal origin. Required for normal proliferation and recruitment of pericytes and vascular smooth muscle cells in the central nervous system, skin, lung, heart and placenta. Required for normal blood vessel development, and for normal development of kidney glomeruli. Plays an important role in wound healing. Signaling is modulated by the formation of heterodimers with PDGFA. A chromosomal aberration involving PDGFB is found in dermatofibrosarcoma protuberans. Translocation t(17;22)(q22;q13) with PDGFB. Belongs to the PDGF/VEGF growth factor family.

Protein type: Motility/polarity/chemotaxis; Oncoprotein; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: basolateral plasma membrane; cell surface; cytoplasm; endoplasmic reticulum lumen; extracellular matrix; extracellular region; extracellular space; Golgi membrane

Molecular Function: chemoattractant activity; collagen binding; growth factor activity; identical protein binding; phosphatidylinositol-4,5-bisphosphate 3-kinase activity; platelet-derived growth factor binding; platelet-derived growth factor receptor binding; protein binding; protein heterodimerization activity; protein homodimerization activity; Ras guanyl-nucleotide exchange factor activity; superoxide-generating NADPH oxidase activator activity

Biological Process: activation of protein kinase activity; activation of protein kinase B; embryonic placenta development; extracellular matrix organization and biogenesis; heart development; hemopoiesis; MAPKKK cascade; monocyte chemotaxis; negative regulation of phosphatidylinositol biosynthetic process; negative regulation of protein binding; negative regulation of transcription, DNA-dependent; peptidyl-serine phosphorylation; peptidyl-tyrosine phosphorylation; phosphoinositide-mediated signaling; platelet degranulation; platelet-derived growth factor receptor signaling pathway; positive regulation of blood vessel endothelial cell migration; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of chemotaxis; positive regulation of cyclin-dependent protein kinase activity; positive regulation of DNA replication; positive regulation of endothelial cell proliferation; positive regulation of fibroblast proliferation; positive regulation of glomerular filtration; positive regulation of MAP kinase activity; positive regulation of MAPKKK cascade; positive regulation of mitosis; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of phosphoinositide 3-kinase activity; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of protein amino acid autophosphorylation; positive regulation of smooth muscle cell migration; positive regulation of smooth muscle cell proliferation; positive regulation of transcription, DNA-dependent; protein amino acid phosphorylation; regulation of phosphoinositide 3-kinase cascade; response to wounding; transforming growth factor beta receptor signaling pathway

Disease: Basal Ganglia Calcification, Idiopathic, 1; Basal Ganglia Calcification, Idiopathic, 5; Dermatofibrosarcoma Protuberans; Meningioma, Familial, Susceptibility To

Research Articles on PDGFB

Similar Products

Product Notes

The PDGFB pdgfb (Catalog #AAA1266755) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcgct gctgggcgct cttcctgtct ctctgctgct acctgcgtct ggtcagcgcc gagggggacc ccattcccga ggagctttat gagatgctga gtgaccactc gatccgctcc tttgatgatc tccaacgcct gctgcacgga gaccccggag aggaagatgg ggccgagttg gacctgaaca tgacccgctc ccactctgga ggcgagctgg agagcttggc tcgtggaaga aggagcctgg gttccctgac cattgctgag ccggccatga tcgccgagtg caagacgcgc accgaggtgt tcgagatctc ccggcgcctc atagaccgca ccaacgccaa cttcctggtg tggccgccct gtgtggaggt gcagcgctgc tccggctgct gcaacaaccg caacgtgcag tgccgcccca cccaggtgca gctgcgacct gtccaggtga gaaagatcga gattgtgcgg aagaagccaa tctttaagaa ggccacggtg acgctggaag accacctggc atgcaagtgt gagacagtgg cagctgcacg gcctgtgacc cgaagcccgg ggggttccca ggagcagcga gccaaaacgc cccaaactcg ggtgaccatt cggacggtgc gagtccgccg gccccccaag ggcaagcacc ggaaattcaa gcacacgcat gacaagacgg cactgaagga gacccttgga gcctag. It is sometimes possible for the material contained within the vial of "PDGFB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.