PDE9A cdna clone
PDE9A cDNA Clone
Gene Names
PDE9A; HSPDE9A2
Synonyms
PDE9A; PDE9A cDNA Clone; PDE9A cdna clone
Sequence
atgggatccggctcctccagctaccggcccaaggccatctacctggacatcgatggacgcattcagaaggtaatcttcagcaagtactgcaactccagcgacatcatggacctgttctgcatcgccaccggcctgcctcggaacacgaccatctccctgctgaccaccgacgacgccatggtctccatcgaccccaccatgcccgcgaattcagaacgcactccgtacaaagtgagacctgtggccatcaagcaactctccgagagagaagaattaatccagagcgtgctggcgcaggttgcagagcagttctcaagagcattcaaaatcaatgaactgaaagctgaagttgcaaatcacttggctgtcctagagaaacgcgtggaattggaaggactaaaagtggtggagattgagaaatgcaagagtgacattaagaagatgagggaggagctggcggccagaagcagcaggaccaactgcccctgtaagtacagttttttggataaccacaagaagttgactcctcgacgcgatgttcccacttaccccaagtacctgctctctccagagaccatcgaggccctgcggaagccgacctttgacgtctggctttgggagcccaatgagatgctgagctgcctggagcacatgtaccacgacctcgggctggtcagggacttcagcatcaaccctgtcaccctcaggaggtggctgttctgcgtccacgacaactacagaaacaaccccttccacaacttccggcactgcttctgcgtggcccagatgatgtacagcatggtctggctctgcagtctccaggagaagttctcacaaacggatatcctgatcctaatgacagcggccatctgccacgatctggaccatcccggctacaacaacacgtaccagatcaatgcccgcacagagctggcggtccgctacaatgacatctcaccgctggagaaccaccactgcgccgtggccttccagatcctcgccgagcctgagtgcaacatcttctccaacatcccacctgatgggttcaagcagatccgacagggaatgatcacattaatcttggccactgacatggcaagacatgcagaaattatggattctttcaaagagaaaatggagaattttgactacagcaacgaggagcacatgaccctgctgaagatgattttgataaaatgctgtgatatctctaacgaggtccgtccaatggaagtcgcagagccttgggtggactgtttattagaggaatattttatgcagagcgaccgtgagaagtcagaaggccttcccgtggccccgttcatggaccgagacaaagtgaccaaggccacagcccagattgggttcatcaagtttgtcctgatcccaatgtttgaaacagtgaccaagctcttccccatggttgaggagatcatgctgcagccactttgggaatcccgagatcgctacgaggagctgaagcggatagatgacgccatgaaagagttacagaagaagactgacagcttgacgtctggggccaccgagaagtccagagagagaagcagagatgtgaaaaacagtgaaggagactgtgcctga
Sequence Length
1602
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,554 Da
NCBI Official Full Name
Homo sapiens phosphodiesterase 9A, mRNA
NCBI Official Synonym Full Names
phosphodiesterase 9A
NCBI Official Symbol
PDE9A
NCBI Official Synonym Symbols
HSPDE9A2
NCBI Protein Information
high affinity cGMP-specific 3',5'-cyclic phosphodiesterase 9A
UniProt Protein Name
High affinity cGMP-specific 3',5'-cyclic phosphodiesterase 9A
Protein Family
UniProt Gene Name
PDE9A
UniProt Entry Name
PDE9A_HUMAN
NCBI Description
The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
PDE9A: Hydrolyzes the second messenger cGMP, which is a key regulator of many important physiological processes. Belongs to the cyclic nucleotide phosphodiesterase family. PDE9 subfamily. 16 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.1.4.35; Nucleotide Metabolism - purine; Phosphodiesterase
Chromosomal Location of Human Ortholog: 21q22.3
Cellular Component: cytosol; sarcolemma
Molecular Function: 3',5'-cyclic-GMP phosphodiesterase activity; 3',5'-cyclic-nucleotide phosphodiesterase activity; protein binding
Biological Process: cGMP catabolic process; cGMP metabolic process; signal transduction
Research Articles on PDE9A
Similar Products
Product Notes
The PDE9A pde9a (Catalog #AAA1273520) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggatccg gctcctccag ctaccggccc aaggccatct acctggacat cgatggacgc attcagaagg taatcttcag caagtactgc aactccagcg acatcatgga cctgttctgc atcgccaccg gcctgcctcg gaacacgacc atctccctgc tgaccaccga cgacgccatg gtctccatcg accccaccat gcccgcgaat tcagaacgca ctccgtacaa agtgagacct gtggccatca agcaactctc cgagagagaa gaattaatcc agagcgtgct ggcgcaggtt gcagagcagt tctcaagagc attcaaaatc aatgaactga aagctgaagt tgcaaatcac ttggctgtcc tagagaaacg cgtggaattg gaaggactaa aagtggtgga gattgagaaa tgcaagagtg acattaagaa gatgagggag gagctggcgg ccagaagcag caggaccaac tgcccctgta agtacagttt tttggataac cacaagaagt tgactcctcg acgcgatgtt cccacttacc ccaagtacct gctctctcca gagaccatcg aggccctgcg gaagccgacc tttgacgtct ggctttggga gcccaatgag atgctgagct gcctggagca catgtaccac gacctcgggc tggtcaggga cttcagcatc aaccctgtca ccctcaggag gtggctgttc tgcgtccacg acaactacag aaacaacccc ttccacaact tccggcactg cttctgcgtg gcccagatga tgtacagcat ggtctggctc tgcagtctcc aggagaagtt ctcacaaacg gatatcctga tcctaatgac agcggccatc tgccacgatc tggaccatcc cggctacaac aacacgtacc agatcaatgc ccgcacagag ctggcggtcc gctacaatga catctcaccg ctggagaacc accactgcgc cgtggccttc cagatcctcg ccgagcctga gtgcaacatc ttctccaaca tcccacctga tgggttcaag cagatccgac agggaatgat cacattaatc ttggccactg acatggcaag acatgcagaa attatggatt ctttcaaaga gaaaatggag aattttgact acagcaacga ggagcacatg accctgctga agatgatttt gataaaatgc tgtgatatct ctaacgaggt ccgtccaatg gaagtcgcag agccttgggt ggactgttta ttagaggaat attttatgca gagcgaccgt gagaagtcag aaggccttcc cgtggccccg ttcatggacc gagacaaagt gaccaaggcc acagcccaga ttgggttcat caagtttgtc ctgatcccaa tgtttgaaac agtgaccaag ctcttcccca tggttgagga gatcatgctg cagccacttt gggaatcccg agatcgctac gaggagctga agcggataga tgacgccatg aaagagttac agaagaagac tgacagcttg acgtctgggg ccaccgagaa gtccagagag agaagcagag atgtgaaaaa cagtgaagga gactgtgcct ga. It is sometimes possible for the material contained within the vial of "PDE9A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
