PDE7A cdna clone
PDE7A cDNA Clone
Gene Names
PDE7A; HCP1; PDE7
Synonyms
PDE7A; PDE7A cDNA Clone; PDE7A cdna clone
Sequence
atgggaattacattgatctggtgtctggccttggttcttatcaagtggatcacctctaagaggcgtggagctatttcctatgacagttctgatcagactgcattatacattcgtatgctaggagatgtacgtgtaaggagccgagcaggatttgaatcagaaagaagaggttctcacccatatattgattttcgtattttccactctcaatctgaaattgaagtgtctgtctctgcaaggaatatcagaaggctactaagtttccagcgatatcttagatcttcacgcttttttcgtggtactgcggtttcaaattccctaaacattttagatgatgattataatggacaagccaagtgtatgctggaaaaagttggaaattggaattttgatatctttctatttgatagactaacaaatggaaatagtctagtaagcttaacctttcatttatttagtcttcatggattaattgagtacttccatttagatatgatgaaacttcgtagatttttagttatgattcaagaagattaccacagtcaaaatccttaccataacgcagtccacgctgcggatgttactcaggccatgcactgttacttaaaggaacctaagcttgccaattctgtaactccttgggatatcttgctgagcttaattgcagctgccactcatgatctggatcatccaggtgttaatcaacctttccttattaaaactaaccattacttggcaactttatacaagaatacctcagtactggaaaatcaccactggagatctgcagtgggcttattgagagaatcaggcttattctcacatctgccattagaaagcaggcaacaaatggagacacagataggtgctctgatactagccacagacatcagtcgccagaatgagtatctgtctttgtttaggtcccatttggatagaggtgatttatgcctagaagacaccagacacagacatttggttttacagatggctttgaaatgtgctgatatttgtaacccatgtcggacgtgggaattaagcaagcagtggagtgaaaaagtaacggaggaattcttccatcaaggagatatagaaaaaaaatatcatttgggtgtgagtccactttgcgatcgtcacactgaatctattgccaacatccagattggttttatgacttacctagtggagcctttatttacagaatgggccaggttttccaatacaaggctatcccagacaatgcttggacacgtggggctgaataaagccagctggaagggactgcagagagaacagtcgagcagtgaggacactgatgctgcatttgagttgaactcacagttattacctcaggaaaatcggttatcataa
Sequence Length
1371
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,828 Da
NCBI Official Full Name
Homo sapiens phosphodiesterase 7A, mRNA
NCBI Official Synonym Full Names
phosphodiesterase 7A
NCBI Official Symbol
PDE7A
NCBI Official Synonym Symbols
HCP1; PDE7
NCBI Protein Information
high affinity cAMP-specific 3',5'-cyclic phosphodiesterase 7A
UniProt Protein Name
High affinity cAMP-specific 3',5'-cyclic phosphodiesterase 7A
Protein Family
UniProt Gene Name
PDE7A
UniProt Entry Name
PDE7A_HUMAN
NCBI Description
The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Uniprot Description
PDE7A: Hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. May have a role in muscle signal transduction. Belongs to the cyclic nucleotide phosphodiesterase family. PDE7 subfamily. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.1.4.53; Phosphodiesterase; Nucleotide Metabolism - purine
Chromosomal Location of Human Ortholog: 8q13
Cellular Component: cytosol
Molecular Function: 3',5'-cyclic-AMP phosphodiesterase activity
Research Articles on PDE7A
Similar Products
Product Notes
The PDE7A pde7a (Catalog #AAA1278231) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaatta cattgatctg gtgtctggcc ttggttctta tcaagtggat cacctctaag aggcgtggag ctatttccta tgacagttct gatcagactg cattatacat tcgtatgcta ggagatgtac gtgtaaggag ccgagcagga tttgaatcag aaagaagagg ttctcaccca tatattgatt ttcgtatttt ccactctcaa tctgaaattg aagtgtctgt ctctgcaagg aatatcagaa ggctactaag tttccagcga tatcttagat cttcacgctt ttttcgtggt actgcggttt caaattccct aaacatttta gatgatgatt ataatggaca agccaagtgt atgctggaaa aagttggaaa ttggaatttt gatatctttc tatttgatag actaacaaat ggaaatagtc tagtaagctt aacctttcat ttatttagtc ttcatggatt aattgagtac ttccatttag atatgatgaa acttcgtaga tttttagtta tgattcaaga agattaccac agtcaaaatc cttaccataa cgcagtccac gctgcggatg ttactcaggc catgcactgt tacttaaagg aacctaagct tgccaattct gtaactcctt gggatatctt gctgagctta attgcagctg ccactcatga tctggatcat ccaggtgtta atcaaccttt ccttattaaa actaaccatt acttggcaac tttatacaag aatacctcag tactggaaaa tcaccactgg agatctgcag tgggcttatt gagagaatca ggcttattct cacatctgcc attagaaagc aggcaacaaa tggagacaca gataggtgct ctgatactag ccacagacat cagtcgccag aatgagtatc tgtctttgtt taggtcccat ttggatagag gtgatttatg cctagaagac accagacaca gacatttggt tttacagatg gctttgaaat gtgctgatat ttgtaaccca tgtcggacgt gggaattaag caagcagtgg agtgaaaaag taacggagga attcttccat caaggagata tagaaaaaaa atatcatttg ggtgtgagtc cactttgcga tcgtcacact gaatctattg ccaacatcca gattggtttt atgacttacc tagtggagcc tttatttaca gaatgggcca ggttttccaa tacaaggcta tcccagacaa tgcttggaca cgtggggctg aataaagcca gctggaaggg actgcagaga gaacagtcga gcagtgagga cactgatgct gcatttgagt tgaactcaca gttattacct caggaaaatc ggttatcata a. It is sometimes possible for the material contained within the vial of "PDE7A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
