Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDE4DIP cdna clone

PDE4DIP cDNA Clone

Gene Names
PDE4DIP; MMGL; CMYA2
Synonyms
PDE4DIP; PDE4DIP cDNA Clone; PDE4DIP cdna clone
Ordering
For Research Use Only!
Sequence
atgtctaatggatatcgcactctgtcccagcacctcaatgacctgaagaaggagaacttcagcctcaagctgctcatctacttcctggaggagcgcatgcaacagaagtatgaggccagccgggaggacatctacaagcggaacactgagctgaaggttgaagtggagagcttgaaacgagaactccaggacaagaaacagcatctggataaaacatgggctgatgtggagaatctcaacagtcagaatgaagctgagctccgacgccagtttgaggagcgacagcaggagacggagcatgtttatgagctcttggagaataagatccagcttctgcaggaggaatccaggctagcaaagaatgaagctgcgcggatggcagctctggtggaagcagagaaggagtgtaacctggagctctcagagaaactgaagggagtcaccaaaaactgggaagatgtaccaggagaccaggtcaagcccgaccaatacactgaggccctggcccagagggacaatccttcaactgacagcttaaagaacttcaggttgttctga
Sequence Length
558
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,507 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:4247433, **** WARNING: chimeric clone ****
NCBI Official Synonym Full Names
phosphodiesterase 4D interacting protein
NCBI Official Symbol
PDE4DIP
NCBI Official Synonym Symbols
MMGL; CMYA2
NCBI Protein Information
myomegalin
UniProt Protein Name
Myomegalin
Protein Family
UniProt Gene Name
PDE4DIP
UniProt Synonym Gene Names
CMYA2; KIAA0454; KIAA0477; MMGL
UniProt Entry Name
MYOME_HUMAN

NCBI Description

The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]

Uniprot Description

PDE4DIP iso1: May function as an anchor sequestering components of the cAMP-dependent pathway to Golgi and/or centrosomes. A chromosomal aberration involving PDE4DIP may be the cause of a myeloproliferative disorder (MBD) associated with eosinophilia. Translocation t(1;5)(q23;q33) that forms a PDE4DIP- PDGFRB fusion protein. 11 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 1q12

Cellular Component: centrosome; cytoplasm; Golgi apparatus; myofibril; nucleus

Molecular Function: enzyme binding; protein binding

Biological Process: cellular protein complex assembly

Research Articles on PDE4DIP

Similar Products

Product Notes

The PDE4DIP pde4dip (Catalog #AAA1277244) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctaatg gatatcgcac tctgtcccag cacctcaatg acctgaagaa ggagaacttc agcctcaagc tgctcatcta cttcctggag gagcgcatgc aacagaagta tgaggccagc cgggaggaca tctacaagcg gaacactgag ctgaaggttg aagtggagag cttgaaacga gaactccagg acaagaaaca gcatctggat aaaacatggg ctgatgtgga gaatctcaac agtcagaatg aagctgagct ccgacgccag tttgaggagc gacagcagga gacggagcat gtttatgagc tcttggagaa taagatccag cttctgcagg aggaatccag gctagcaaag aatgaagctg cgcggatggc agctctggtg gaagcagaga aggagtgtaa cctggagctc tcagagaaac tgaagggagt caccaaaaac tgggaagatg taccaggaga ccaggtcaag cccgaccaat acactgaggc cctggcccag agggacaatc cttcaactga cagcttaaag aacttcaggt tgttctga. It is sometimes possible for the material contained within the vial of "PDE4DIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.