Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDCL3 cdna clone

PDCL3 cDNA Clone

Gene Names
PDCL3; VIAF; PHLP3; VIAF1; HTPHLP; PHLP2A
Synonyms
PDCL3; PDCL3 cDNA Clone; PDCL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggaccccaacgcagacactgaatggaatgacatcttacgcaaaaagggtatcttaccccccaaggaaagtctgaaagaattggaagaggaggcagaagaggagcagcgcatcctccagcagtcagtggtgaaaacatatgaagatatgactttggaagagctggaggatcatgaagacgagtttaatgaggaggatgaacgtgctattgaaatgtacagacggcggagactggctgagtggaaagcaactaaactgaagaataaattcggagaagttttggagatctcagggaaggattatgttcaagaagttaccaaagctggcgagggcttgtgggtcatcttgcacctttacaaacaaggaattcccctctgtgccctgataaatcagcacctcagtggacttgccaggaagtttcctgatgtcaaatttatcaaagccatttcaacaacctgcatacccaattatcctgataggaatctgcccacgatatttgtttacctggaaggagatatcaaggctcagtttattggtcctctggtgtttggcggcatgaacctgacaagagatgagttggaatggaaactgtctgaatctggagcaattatgacagacctggaggaaaaccctaagaagccgattgaagacgtgttgctgtcctcagtgcggcgctctgtcctcatgaagagggacagcgattccgagggtgactga
Sequence Length
720
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,614 Da
NCBI Official Full Name
Homo sapiens phosducin-like 3, mRNA
NCBI Official Synonym Full Names
phosducin like 3
NCBI Official Symbol
PDCL3
NCBI Official Synonym Symbols
VIAF; PHLP3; VIAF1; HTPHLP; PHLP2A
NCBI Protein Information
phosducin-like protein 3
UniProt Protein Name
Phosducin-like protein 3
Protein Family
UniProt Gene Name
PDCL3
UniProt Synonym Gene Names
PhLP2A; VIAF1; VIAF-1
UniProt Entry Name
PDCL3_HUMAN

NCBI Description

This gene encodes a member of the phosducin-like protein family and is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin. Members of the phosducin-like protein family have been shown to bind to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]

Uniprot Description

PDCL3: Modulates the activation of caspases during apoptosis. Is a substrate for Orgyia pseudotsugata multicapsid polyhedrosis virus (OpMNPV) IAP-mediated ubiquitination. Belongs to the phosducin family.

Protein type: Apoptosis

Chromosomal Location of Human Ortholog: 2q11.2

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding; queuine tRNA-ribosyltransferase activity

Biological Process: positive regulation of angiogenesis; positive regulation of endothelial cell proliferation; queuosine biosynthetic process; regulation of peptidyl-tyrosine phosphorylation

Research Articles on PDCL3

Similar Products

Product Notes

The PDCL3 pdcl3 (Catalog #AAA1273318) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggacc ccaacgcaga cactgaatgg aatgacatct tacgcaaaaa gggtatctta ccccccaagg aaagtctgaa agaattggaa gaggaggcag aagaggagca gcgcatcctc cagcagtcag tggtgaaaac atatgaagat atgactttgg aagagctgga ggatcatgaa gacgagttta atgaggagga tgaacgtgct attgaaatgt acagacggcg gagactggct gagtggaaag caactaaact gaagaataaa ttcggagaag ttttggagat ctcagggaag gattatgttc aagaagttac caaagctggc gagggcttgt gggtcatctt gcacctttac aaacaaggaa ttcccctctg tgccctgata aatcagcacc tcagtggact tgccaggaag tttcctgatg tcaaatttat caaagccatt tcaacaacct gcatacccaa ttatcctgat aggaatctgc ccacgatatt tgtttacctg gaaggagata tcaaggctca gtttattggt cctctggtgt ttggcggcat gaacctgaca agagatgagt tggaatggaa actgtctgaa tctggagcaa ttatgacaga cctggaggaa aaccctaaga agccgattga agacgtgttg ctgtcctcag tgcggcgctc tgtcctcatg aagagggaca gcgattccga gggtgactga. It is sometimes possible for the material contained within the vial of "PDCL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.