Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PCMTD2 cdna clone

PCMTD2 cDNA Clone

Gene Names
PCMTD2; C20orf36
Synonyms
PCMTD2; PCMTD2 cDNA Clone; PCMTD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcggtgctgtgagtgctggtgaagacaatgatgagctgatagataatttgaaagaagcacagtatatccggactgagctggtagagcaggctttcagagctatcgatcgtgcagactattatcttgaagaatttaaagaaaatgcttataaagacttggcatggaagcatggaaacattcacctctcagccccgtgcatctactcggaggtgatggaagccctagatctgcagcctggactctcgtttctgaacctgggcagtggcactgggtatctcagctccatggtgggcctcattctaggtccttttggtgtgaaccatggggtggaacttcactcagatgtgatagagtatgcaaagcagaaactggacttcttcatcagaacaagtgatagttttgacaagtttgacttctgtgaaccttcctttgttactgggaattgcctggagatttctccggattgttctcagtatgatcgtgtatactgtggggctggcgtgcagaaagagcatgaagagtacatgaagaatcttctcaaagtgggagggatccttgtcatgccactggaagagaagttgactaagataacacgcacaggtccttcagcttgggaaaccaaaaagattcttgctgtttcttttgctcctctgatccagccctgccattcagagtcaggaaaatcaagacttgtccagttaccaccagtggcagttcgcagcctccaggacttggctcgcatcgccatccggggcaccattaaaaagattattcatcaggaaactgtgagcaaaaacggaaacggactaaagaacacccccaggtttaaacgaaggagagttcgccgccgtcgaatggaaacgattgtctttttggacaaagaagtctttgccagtcggatttccaacccctcagatgacaacagctgtgaagacttggaagaggaacggagggaagaagaagagaagaccccgccggaaacaaagccagaccccccagtgaacttcctacgccagaaggtcctgagcctccctctgccagatcccctgaaatactacttgctttattacagagaaaaataa
Sequence Length
1086
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,089 Da
NCBI Official Full Name
Homo sapiens protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2, mRNA
NCBI Official Synonym Full Names
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
NCBI Official Symbol
PCMTD2
NCBI Official Synonym Symbols
C20orf36
NCBI Protein Information
protein-L-isoaspartate O-methyltransferase domain-containing protein 2
UniProt Protein Name
Protein-L-isoaspartate O-methyltransferase domain-containing protein 2
UniProt Gene Name
PCMTD2
UniProt Synonym Gene Names
C20orf36
UniProt Entry Name
PCMD2_HUMAN

Uniprot Description

PCMTD2: Belongs to the methyltransferase superfamily. L- isoaspartyl/D-aspartyl protein methyltransferase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 20q13.33

Cellular Component: cytoplasm

Molecular Function: protein-L-isoaspartate (D-aspartate) O-methyltransferase activity

Similar Products

Product Notes

The PCMTD2 pcmtd2 (Catalog #AAA1269268) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcggtg ctgtgagtgc tggtgaagac aatgatgagc tgatagataa tttgaaagaa gcacagtata tccggactga gctggtagag caggctttca gagctatcga tcgtgcagac tattatcttg aagaatttaa agaaaatgct tataaagact tggcatggaa gcatggaaac attcacctct cagccccgtg catctactcg gaggtgatgg aagccctaga tctgcagcct ggactctcgt ttctgaacct gggcagtggc actgggtatc tcagctccat ggtgggcctc attctaggtc cttttggtgt gaaccatggg gtggaacttc actcagatgt gatagagtat gcaaagcaga aactggactt cttcatcaga acaagtgata gttttgacaa gtttgacttc tgtgaacctt cctttgttac tgggaattgc ctggagattt ctccggattg ttctcagtat gatcgtgtat actgtggggc tggcgtgcag aaagagcatg aagagtacat gaagaatctt ctcaaagtgg gagggatcct tgtcatgcca ctggaagaga agttgactaa gataacacgc acaggtcctt cagcttggga aaccaaaaag attcttgctg tttcttttgc tcctctgatc cagccctgcc attcagagtc aggaaaatca agacttgtcc agttaccacc agtggcagtt cgcagcctcc aggacttggc tcgcatcgcc atccggggca ccattaaaaa gattattcat caggaaactg tgagcaaaaa cggaaacgga ctaaagaaca cccccaggtt taaacgaagg agagttcgcc gccgtcgaat ggaaacgatt gtctttttgg acaaagaagt ctttgccagt cggatttcca acccctcaga tgacaacagc tgtgaagact tggaagagga acggagggaa gaagaagaga agaccccgcc ggaaacaaag ccagaccccc cagtgaactt cctacgccag aaggtcctga gcctccctct gccagatccc ctgaaatact acttgcttta ttacagagaa aaataa. It is sometimes possible for the material contained within the vial of "PCMTD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.