PCGF5 cdna clone
PCGF5 cDNA Clone
Gene Names
PCGF5; RNF159
Synonyms
PCGF5; PCGF5 cDNA Clone; PCGF5 cdna clone
Sequence
atggctacccaaaggaaacacttggtgaaagattttaatccttacattacctgctatatctgtaaagggtatctgatcaagccaacaacagtgacggaatgcctccatacattctgtaagacttgtattgttcagcactttgaagatagcaatgattgcccaaggtgtggcaaccaagttcatgagacaaatccattagaaatgttgaggttggacaatacattagaggaaattatatttaagctggtccctggactacgagaacaagaacttgagcgtgaatctgaattttggaagaaaaataagcctcaagaaaatggacaagatgatacttcaaaagctgacaaaccgaaagtagatgaagaaggtgatgaaaatgaagatgataaagattatcacagaagtgacccacaaattgctatctgtctagattgtttacgaaataatgggcaatcaggggacaatgtagtaaagggtttaatgaagaaattcattcgatgttctacacgtgtaactgtgggaactattaaaaaatttctaagtttaaaactaaaacttccaagttcttatgagttggatgtgctgtgcaatggtgaaattatggggaaggatcatactatggaattcatctacatgacaagatggcgactaagaggcgaaaactttcggtgtctgaactgctcagcttcgcaagtctgctctcaggatggccctttgtatcagtcataccctatggtactgcagtatcgaccaagaattgatttcggttag
Sequence Length
771
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
5,779 Da
NCBI Official Full Name
Homo sapiens polycomb group ring finger 5, mRNA
NCBI Official Synonym Full Names
polycomb group ring finger 5
NCBI Official Symbol
PCGF5
NCBI Official Synonym Symbols
RNF159
NCBI Protein Information
polycomb group RING finger protein 5
UniProt Protein Name
Polycomb group RING finger protein 5
Protein Family
UniProt Gene Name
PCGF5
UniProt Synonym Gene Names
RNF159
UniProt Entry Name
PCGF5_HUMAN
Uniprot Description
PCGF5: Component of a Polycomb group (PcG) multiprotein PRC1- like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 10q23.32
Cellular Component: centrosome; nucleolus; nucleus; PcG protein complex
Molecular Function: protein binding
Biological Process: positive regulation of transcription from RNA polymerase II promoter
Research Articles on PCGF5
Similar Products
Product Notes
The PCGF5 pcgf5 (Catalog #AAA1266531) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaccc aaaggaaaca cttggtgaaa gattttaatc cttacattac ctgctatatc tgtaaagggt atctgatcaa gccaacaaca gtgacggaat gcctccatac attctgtaag acttgtattg ttcagcactt tgaagatagc aatgattgcc caaggtgtgg caaccaagtt catgagacaa atccattaga aatgttgagg ttggacaata cattagagga aattatattt aagctggtcc ctggactacg agaacaagaa cttgagcgtg aatctgaatt ttggaagaaa aataagcctc aagaaaatgg acaagatgat acttcaaaag ctgacaaacc gaaagtagat gaagaaggtg atgaaaatga agatgataaa gattatcaca gaagtgaccc acaaattgct atctgtctag attgtttacg aaataatggg caatcagggg acaatgtagt aaagggttta atgaagaaat tcattcgatg ttctacacgt gtaactgtgg gaactattaa aaaatttcta agtttaaaac taaaacttcc aagttcttat gagttggatg tgctgtgcaa tggtgaaatt atggggaagg atcatactat ggaattcatc tacatgacaa gatggcgact aagaggcgaa aactttcggt gtctgaactg ctcagcttcg caagtctgct ctcaggatgg ccctttgtat cagtcatacc ctatggtact gcagtatcga ccaagaattg atttcggtta g. It is sometimes possible for the material contained within the vial of "PCGF5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
