PCBD1 cdna clone

PCBD1

Cat. Num. AAA200636

• Gene Names: PCBD1; PCD; PHS; DCOH; PCBD
• Synonyms: PCBD1; DCOH; PCBD; PCD; PHS; PCBD1 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGCTGGCAAAGCACACAGGCTGAGCGCTGAGGAGAGGGACCAGCTGCTGCCAAACCTGAGGGCTGTGGGGTGGAATGAGCTGGAAGGCCGTGATGCCATCTTCAAGCAGTTTCATTTCAAAGACTTCAACAGGGCCTTTGGGTTCATGACAAGAGTGGCCCTGCAGGCTGAGAAACTGGACCACCATCCTGAATGGTTTAACGTGTACAACAAGGTCCACATCACGCTGAGCACCCATGAGTGTGCCGGCCTTTCAGAACGGGACATAAACCTGGCCAGCTTCATCGAACAAGTAGCAGTGTCCATGACATAG; ; Translation Sequence: MAGKAHRLSA EERDQLLPNL RAVGWNELEG RDAIFKQFHF KDFNRAFGFM TRVALQAEKL DHHPEWFNVY NKVHITLSTH ECAGLSERDI NLASFIEQVA VSMT
• Sequence Length: 104

• Species: Human
• Chromosome Location: 10q22
• OMIM Reference Number: 126090
• cDNA Size: 315bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for PCBD1 cdna clone

PCBD1 encodes a member of the pterin-4-alpha-carbinolamine dehydratase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein functions as both a dehydratase involved in tetrahydrobiopterin biosynthesis, and as a cofactor for HNF1A-dependent transcription. A deficiency of this enzyme leads to hyperphenylalaninemia. Alternative splicing results in multiple transcript variants.

Product Categories/Family for PCBD1 cdna clone

Metabolism; Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 4557831
• NCBI GeneID: 5092
• NCBI Accession #: NP_000272.1
• NCBI GenBank Nucleotide #: NM_000281.3
• UniProt Accession #: P61457
• NCBI Official Full Name: pterin-4-alpha-carbinolamine dehydratase isoform 1
• NCBI Official Synonym Full Names: pterin-4 alpha-carbinolamine dehydratase 1
• NCBI Official Symbol: PCBD1
• NCBI Official Synonym Symbols: PCD; PHS; DCOH; PCBD
• NCBI Protein Information: pterin-4-alpha-carbinolamine dehydratase
• UniProt Protein Name: Pterin-4-alpha-carbinolamine dehydratase
• Protein Family: Pterin-4-alpha-carbinolamine dehydratase
• UniProt Gene Name: PCBD1
• UniProt Synonym Gene Names: DCOH; PCBD; PHS; DCoH; Dimerization cofactor of HNF1; PCD
• UniProt Entry Name: PHS_HUMAN

NCBI Description

This gene encodes a member of the pterin-4-alpha-carbinolamine dehydratase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein functions as both a dehydratase involved in tetrahydrobiopterin biosynthesis, and as a cofactor for HNF1A-dependent transcription. A deficiency of this enzyme leads to hyperphenylalaninemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

PCBD1: Involved in tetrahydrobiopterin biosynthesis. Seems to both prevent the formation of 7-pterins and accelerate the formation of quinonoid-BH2. Coactivator for HNF1A-dependent transcription. Regulates the dimerization of homeodomain protein HNF1A and enhances its transcriptional activity. Defects in PCBD1 are the cause of BH4-deficient hyperphenylalaninemia type D (HPABH4D); also known as hyperphenylalaninemia with primapterinuria. HPABH4D is characterized by the excretion of 7-substituted pterins in the urine of affected patients. Belongs to the pterin-4-alpha-carbinolamine dehydratase family.

Protein type: Transcription, coactivator/corepressor; Oxidoreductase; Lyase; EC 4.2.1.96

Chromosomal Location of Human Ortholog: 10q22

Cellular Component: nucleoplasm; cytoplasm; cytosol

Molecular Function: identical protein binding; protein binding; 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; transcription coactivator activity; phenylalanine 4-monooxygenase activity

Biological Process: tetrahydrobiopterin biosynthetic process; L-phenylalanine catabolic process; transcription, DNA-dependent; protein heterooligomerization; regulation of protein homodimerization activity; positive regulation of transcription, DNA-dependent; protein homotetramerization

Disease: Hyperphenylalaninemia, Bh4-deficient, D