Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PARVB cdna clone

PARVB cDNA Clone

Gene Names
PARVB; CGI-56
Synonyms
PARVB; PARVB cDNA Clone; PARVB cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaaggacgagtcgttcctgggcaagctgggcggcaccctggccaggaagcggagggcgcgcgaggtgagtgacctgcaggaagaaggcaagaatgccatcaactcaccgatgtcccccgccctggcggatgttcaccctgaagacacccagctcgaggagaacgaggagcgcacgatgattgaccccacttccaaggaagaccccaagttcaaggaactggtcaaggtcctcctcgactggattaatgacgtgctggtggaggagaggatcattgtgaagcagctggaggaagacctgtatgacggccaggtgctgcagaagctcttggaaaaactggcagggtgcaagctgaatgtggctgaggtgacacagtccgaaatagggcagaaacagaagctgcagacggtgctggaagcagtacatgacctgctgcggccccgaggctgggcgctccggtggagcgtggactcaattcacgggaagaacctggtggccatcctccacctgctggtctctctggccatgcacttcagggcccccatccgccttcctgagcatgtaacggtgcaggtggtggtcgtgcggaaacgggaaggcctgctgcattccagccacatctcggaggagctgaccacaactacagagatgatgatgggccggttcgagcgggatgccttcgacacgctgttcgaccacgccccggataagctcagcgtggtgaagaagtctctcatcacttttgtgaacaagcacctgaacaagctgaatttggaggtgacggaactggagacccagtttgcagatggcgtgtacctggttctgctcatgggccttctggaagactactttgttcctctccaccacttctacctgactccggaaagcttcgatcagaaggtccacaatgtgtcctttgcctttgagctgatgctggacggaggcctcaagaaacccaaggctcgtcctgaagacgtggttaacttggacctcaaatccaccctgagggttctttacaacctgttcaccaagtacaagaacgtggagtga
Sequence Length
1053
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,538 Da
NCBI Official Full Name
Homo sapiens parvin, beta, mRNA
NCBI Official Synonym Full Names
parvin beta
NCBI Official Symbol
PARVB
NCBI Official Synonym Symbols
CGI-56
NCBI Protein Information
beta-parvin
UniProt Protein Name
Beta-parvin
Protein Family
UniProt Gene Name
PARVB
UniProt Entry Name
PARVB_HUMAN

NCBI Description

This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Uniprot Description

PARVB: Probably plays a role in the regulation of cell adhesion and cytoskeleton organization. Belongs to the parvin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Actin-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 22q13.2-q13.33

Cellular Component: cytosol; focal adhesion; lamellipodium

Molecular Function: protein binding

Biological Process: actin cytoskeleton reorganization; cell projection biogenesis; lamellipodium biogenesis

Research Articles on PARVB

Similar Products

Product Notes

The PARVB parvb (Catalog #AAA1275736) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaagg acgagtcgtt cctgggcaag ctgggcggca ccctggccag gaagcggagg gcgcgcgagg tgagtgacct gcaggaagaa ggcaagaatg ccatcaactc accgatgtcc cccgccctgg cggatgttca ccctgaagac acccagctcg aggagaacga ggagcgcacg atgattgacc ccacttccaa ggaagacccc aagttcaagg aactggtcaa ggtcctcctc gactggatta atgacgtgct ggtggaggag aggatcattg tgaagcagct ggaggaagac ctgtatgacg gccaggtgct gcagaagctc ttggaaaaac tggcagggtg caagctgaat gtggctgagg tgacacagtc cgaaataggg cagaaacaga agctgcagac ggtgctggaa gcagtacatg acctgctgcg gccccgaggc tgggcgctcc ggtggagcgt ggactcaatt cacgggaaga acctggtggc catcctccac ctgctggtct ctctggccat gcacttcagg gcccccatcc gccttcctga gcatgtaacg gtgcaggtgg tggtcgtgcg gaaacgggaa ggcctgctgc attccagcca catctcggag gagctgacca caactacaga gatgatgatg ggccggttcg agcgggatgc cttcgacacg ctgttcgacc acgccccgga taagctcagc gtggtgaaga agtctctcat cacttttgtg aacaagcacc tgaacaagct gaatttggag gtgacggaac tggagaccca gtttgcagat ggcgtgtacc tggttctgct catgggcctt ctggaagact actttgttcc tctccaccac ttctacctga ctccggaaag cttcgatcag aaggtccaca atgtgtcctt tgcctttgag ctgatgctgg acggaggcct caagaaaccc aaggctcgtc ctgaagacgt ggttaacttg gacctcaaat ccaccctgag ggttctttac aacctgttca ccaagtacaa gaacgtggag tga. It is sometimes possible for the material contained within the vial of "PARVB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.