Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PARVA cdna clone

PARVA cDNA Clone

Gene Names
PARVA; MXRA2; CH-ILKBP
Synonyms
PARVA; PARVA cDNA Clone; PARVA cdna clone
Ordering
For Research Use Only!
Sequence
atggccacctccccgcagaagtcgccttctgcccccaagtctcccactcccaagtcgcccccgtcccgcaagaaagatgattccttcttggggaaactcggagggaccctggcccggaggaagaaagccaaggaggtgtccgagctgcaggaggagggaatgaacgccatcaacctgcccctcagcccaattccctttgagctggaccccgaggacacgatgctggaggagaatgaggtgcgaacaatggtggatccaaactcacgcagtgaccccaagcttcaagaactgatgaaggtattaattgactggattaatgatgtgttggttggagaaagaatcattgtgaaagacctagctgaagatttgtatgatggacaagtcctgcagaagcttttcgagaaactggagagtgagaagctaaatgtggctgaggtcacccagtcagagattgctcagaagcaaaaactgcagactgtcctggagaagatcaatgaaaccctgaaacttcctcccaggagcatcaagtggaatgtggattctgttcatgccaagagcctggtggccatcttacacctgctcgttgctctgtctcagtatttccgcgcaccaattcgactcccagaccatgtttccatccaagtggttgtggtccagaaacgagaaggaatcctccagtctcggcaaatccaagaggaaataactggtaacacagaggctctttccgggaggcatgaacgtgatgcctttgacaccttgttcgaccatgccccagacaagctgaatgtggtgaaaaagacactcatcactttcgtgaacaagcacctgaataaactgaacctggaggtcacagaactggaaacccagtttgcagatggggtgtacctggtgctgctcatggggctcctggagggctactttgtgcccctgcacagcttcttcctgaccccggacagctttgaacagaaggtcttgaatgtctcctttgcctttgagctcatgcaagatggagggttggaaaagccaaaaccgcggccagaagacatagtcaactgtgacctgaaatctacactacgagtgttgtacaacctcttcaccaagtaccgtaacgtggagtga
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,625 Da
NCBI Official Full Name
Homo sapiens parvin, alpha, mRNA
NCBI Official Synonym Full Names
parvin alpha
NCBI Official Symbol
PARVA
NCBI Official Synonym Symbols
MXRA2; CH-ILKBP
NCBI Protein Information
alpha-parvin
UniProt Protein Name
Alpha-parvin
Protein Family
UniProt Gene Name
PARVA
UniProt Synonym Gene Names
MXRA2
UniProt Entry Name
PARVA_HUMAN

NCBI Description

This gene encodes a member of the parvin family of actin-binding proteins. Parvins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. The encoded protein is part of the integrin-linked kinase signaling complex and plays a role in cell adhesion, motility and survival. [provided by RefSeq, Dec 2010]

Uniprot Description

PARVA: Probably plays a role in the regulation of cell adhesion and cytoskeleton organization. Plays a role in ciliogenesis. Interacts with TGFB1I1. Interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Interacts with ARHGAP31. Widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Belongs to the parvin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 11p15.3

Cellular Component: cell-cell adherens junction; cytosol; focal adhesion

Molecular Function: protein binding

Biological Process: establishment and/or maintenance of cell polarity; heterotypic cell-cell adhesion; sprouting angiogenesis

Research Articles on PARVA

Similar Products

Product Notes

The PARVA parva (Catalog #AAA1268241) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacct ccccgcagaa gtcgccttct gcccccaagt ctcccactcc caagtcgccc ccgtcccgca agaaagatga ttccttcttg gggaaactcg gagggaccct ggcccggagg aagaaagcca aggaggtgtc cgagctgcag gaggagggaa tgaacgccat caacctgccc ctcagcccaa ttccctttga gctggacccc gaggacacga tgctggagga gaatgaggtg cgaacaatgg tggatccaaa ctcacgcagt gaccccaagc ttcaagaact gatgaaggta ttaattgact ggattaatga tgtgttggtt ggagaaagaa tcattgtgaa agacctagct gaagatttgt atgatggaca agtcctgcag aagcttttcg agaaactgga gagtgagaag ctaaatgtgg ctgaggtcac ccagtcagag attgctcaga agcaaaaact gcagactgtc ctggagaaga tcaatgaaac cctgaaactt cctcccagga gcatcaagtg gaatgtggat tctgttcatg ccaagagcct ggtggccatc ttacacctgc tcgttgctct gtctcagtat ttccgcgcac caattcgact cccagaccat gtttccatcc aagtggttgt ggtccagaaa cgagaaggaa tcctccagtc tcggcaaatc caagaggaaa taactggtaa cacagaggct ctttccggga ggcatgaacg tgatgccttt gacaccttgt tcgaccatgc cccagacaag ctgaatgtgg tgaaaaagac actcatcact ttcgtgaaca agcacctgaa taaactgaac ctggaggtca cagaactgga aacccagttt gcagatgggg tgtacctggt gctgctcatg gggctcctgg agggctactt tgtgcccctg cacagcttct tcctgacccc ggacagcttt gaacagaagg tcttgaatgt ctcctttgcc tttgagctca tgcaagatgg agggttggaa aagccaaaac cgcggccaga agacatagtc aactgtgacc tgaaatctac actacgagtg ttgtacaacc tcttcaccaa gtaccgtaac gtggagtga. It is sometimes possible for the material contained within the vial of "PARVA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.