Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PARP9 cdna clone

PARP9 cDNA Clone

Gene Names
PARP9; BAL; BAL1; ARTD9; MGC:7868
Synonyms
PARP9; PARP9 cDNA Clone; PARP9 cdna clone
Ordering
For Research Use Only!
Sequence
atggacttttccatggtggccggagcagcagcttacaatgaaaaatcagagactggtgctcttggagaaaactatagttggcaaattcccattaaccacaatgacttcaaaattttaaaaaataatgagcgtcagctgtgtgaagtcctccagaataagtttggctgtatctctaccctggtctctccagttcaggaaggcaacagcaaatctctgcaagtgttcagaaaaatgctgactcctaggatagagttatcagtctggaaagatgacctcaccacacatgctgttgatgctgtggtgaatgcagccaatgaagatcttctgcatgggggaggcctggccctggccctggtaaaagctggtggatttgaaatccaagaagagagcaaacagtttgttgccagatatggtaaagtgtcagctggtgagatagctgtcacgggagcagggaggcttccctgcaaacagatcatccatgctgttgggcctcggtggatggaatgggataaacagggatgtactggaaagctgcagagggccattgtaagtattctgaattatgtcatctataaaaatactcacattaagacagtagcaattccagccttgagctctgggatttttcagttccctctgaatttgtgtacaaagactattgtagagactatccgggttagtttgcaagggaagccaatgatgagtaatttgaaagaaattcacctggtgagcaatgaggaccctactgttgctgcctttaaagctgcttcagaattcatcctagggaagagtgagctgggacaagaaaccaccccttctttcaatgcaatggtcgtgaacaacctgaccctccagattgtccagggccacattgaatggcagacggcagatgtaattgttaattctgtaaacccacatgatattacagttggacctgtggcaaagtcaattctacaacaagcaggagttgaaatgaaatcggaatttcttgccacaaaggctaaacagtttcaacggtcccagttggtactggtcacaaaaggatttaacttgttctgtaaatatatataccatgtactgtggcattcagaatttcctaaacctcagatattaaaacatgcaatgaaggagtgtttggaaaaatgcattgagcaaaatataacttccatttcctttcctgcccttgggactggaaacatggaaataaagaaggaaacagcagcagagattttgtttgatgaagttttaacatttgccaaagaccatgtaaaacaccagttaactgtaaaatttgtgatctttccaacagatttggagatatataaggctttcagttctgaaatggcaaagaggtccaagatgctgagtttgaacaattacagtgtcccccagtcaaccagagaggagaaaagagaaaatgggcttgaagctagatctcctgccatcaatctgatgggattcaacgtggaagagatgtatgaggcccacgcatggatccaaagaatcctgagtctccagaaccaccacatcattgagaataatcatattctgtaccttgggagaaaggaacatgacattttgtctcagcttcagaaaacttcaagtgtctccatcacagaaattatcagcccaggaaggacagagttagagattgaaggagcccgggctgacctcattgaggtggttatgaacattgaagatatgctttgtaaagtacaggaggaaatggcaaggaaaaaggagcgaggcctttggcgctcgttaggacagtggactattcagcaacaaaaaacccaagacgaaatgaaagaaaatatcatatttctgaaatgtcctgtgcctccaactcaagagcttctagatcaaaagaaacagtttgaaaaatgtggtttgcaggttctaaaggtggagaagatagacaatgaggtccttatggctgcctttcaaagaaagaagaaaatgatggaagaaaaactgcacaggcaacctgtgagccataggctgtttcagcaagtcccataccagttctgcaatgtggtatgcagagttggctttcaaagaatgtactcgacaccttgcgatccaaaatacggagctggcatatacttcaccaagaacctcaaaaacctggcagagaaggccaagaaaatctctgctgcagataagctgatctatgtgtttgaggctgaagtactcacaggcttcttctgccagggacatccgttaaatattgttcccccaccactgagtcctggagctatagatggtcatgacagtgtggttgacaatgtctccagccctgaaacctttgttatttttagtggcatgcaggctatacctcagtatttgtggacatgcacccaggaatatgtacagtcacaagattactcatcaggaccaatgagaccctttgcacagcatccttggaggggattcgcaagtggcagccctgttgattaa
Sequence Length
2460
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,291 Da
NCBI Official Full Name
Homo sapiens poly (ADP-ribose) polymerase family, member 9, mRNA
NCBI Official Synonym Full Names
poly(ADP-ribose) polymerase family member 9
NCBI Official Symbol
PARP9
NCBI Official Synonym Symbols
BAL; BAL1; ARTD9; MGC:7868
NCBI Protein Information
poly [ADP-ribose] polymerase 9
UniProt Protein Name
Poly [ADP-ribose] polymerase 9
UniProt Gene Name
PARP9
UniProt Synonym Gene Names
BAL; BAL1; PARP-9; ARTD9
UniProt Entry Name
PARP9_HUMAN

Uniprot Description

PARP9: Involved in inducing the expression of IFN-gamma- responsive genes. Overexpressed at significantly higher levels in fatal high-risk diffuse large B-cell lymphomas (DLB-CL) compared to cured low-risk tumors. Overexpression in B-cell lymphoma transfectants may promote malignant B-cell migration. May therefore be involved in promoting B-cell migration and dissemination of high-risk DLB-CL tumors. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.4.2.30; Transferase; Motility/polarity/chemotaxis; Cell adhesion

Chromosomal Location of Human Ortholog: 3q21

Cellular Component: cytoplasm; membrane; mitochondrion; nucleoplasm; nucleus

Molecular Function: NAD+ ADP-ribosyltransferase activity; protein binding

Biological Process: cell migration; double-strand break repair

Research Articles on PARP9

Similar Products

Product Notes

The PARP9 parp9 (Catalog #AAA1269279) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactttt ccatggtggc cggagcagca gcttacaatg aaaaatcaga gactggtgct cttggagaaa actatagttg gcaaattccc attaaccaca atgacttcaa aattttaaaa aataatgagc gtcagctgtg tgaagtcctc cagaataagt ttggctgtat ctctaccctg gtctctccag ttcaggaagg caacagcaaa tctctgcaag tgttcagaaa aatgctgact cctaggatag agttatcagt ctggaaagat gacctcacca cacatgctgt tgatgctgtg gtgaatgcag ccaatgaaga tcttctgcat gggggaggcc tggccctggc cctggtaaaa gctggtggat ttgaaatcca agaagagagc aaacagtttg ttgccagata tggtaaagtg tcagctggtg agatagctgt cacgggagca gggaggcttc cctgcaaaca gatcatccat gctgttgggc ctcggtggat ggaatgggat aaacagggat gtactggaaa gctgcagagg gccattgtaa gtattctgaa ttatgtcatc tataaaaata ctcacattaa gacagtagca attccagcct tgagctctgg gatttttcag ttccctctga atttgtgtac aaagactatt gtagagacta tccgggttag tttgcaaggg aagccaatga tgagtaattt gaaagaaatt cacctggtga gcaatgagga ccctactgtt gctgccttta aagctgcttc agaattcatc ctagggaaga gtgagctggg acaagaaacc accccttctt tcaatgcaat ggtcgtgaac aacctgaccc tccagattgt ccagggccac attgaatggc agacggcaga tgtaattgtt aattctgtaa acccacatga tattacagtt ggacctgtgg caaagtcaat tctacaacaa gcaggagttg aaatgaaatc ggaatttctt gccacaaagg ctaaacagtt tcaacggtcc cagttggtac tggtcacaaa aggatttaac ttgttctgta aatatatata ccatgtactg tggcattcag aatttcctaa acctcagata ttaaaacatg caatgaagga gtgtttggaa aaatgcattg agcaaaatat aacttccatt tcctttcctg cccttgggac tggaaacatg gaaataaaga aggaaacagc agcagagatt ttgtttgatg aagttttaac atttgccaaa gaccatgtaa aacaccagtt aactgtaaaa tttgtgatct ttccaacaga tttggagata tataaggctt tcagttctga aatggcaaag aggtccaaga tgctgagttt gaacaattac agtgtccccc agtcaaccag agaggagaaa agagaaaatg ggcttgaagc tagatctcct gccatcaatc tgatgggatt caacgtggaa gagatgtatg aggcccacgc atggatccaa agaatcctga gtctccagaa ccaccacatc attgagaata atcatattct gtaccttggg agaaaggaac atgacatttt gtctcagctt cagaaaactt caagtgtctc catcacagaa attatcagcc caggaaggac agagttagag attgaaggag cccgggctga cctcattgag gtggttatga acattgaaga tatgctttgt aaagtacagg aggaaatggc aaggaaaaag gagcgaggcc tttggcgctc gttaggacag tggactattc agcaacaaaa aacccaagac gaaatgaaag aaaatatcat atttctgaaa tgtcctgtgc ctccaactca agagcttcta gatcaaaaga aacagtttga aaaatgtggt ttgcaggttc taaaggtgga gaagatagac aatgaggtcc ttatggctgc ctttcaaaga aagaagaaaa tgatggaaga aaaactgcac aggcaacctg tgagccatag gctgtttcag caagtcccat accagttctg caatgtggta tgcagagttg gctttcaaag aatgtactcg acaccttgcg atccaaaata cggagctggc atatacttca ccaagaacct caaaaacctg gcagagaagg ccaagaaaat ctctgctgca gataagctga tctatgtgtt tgaggctgaa gtactcacag gcttcttctg ccagggacat ccgttaaata ttgttccccc accactgagt cctggagcta tagatggtca tgacagtgtg gttgacaatg tctccagccc tgaaaccttt gttattttta gtggcatgca ggctatacct cagtatttgt ggacatgcac ccaggaatat gtacagtcac aagattactc atcaggacca atgagaccct ttgcacagca tccttggagg ggattcgcaa gtggcagccc tgttgattaa. It is sometimes possible for the material contained within the vial of "PARP9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.