PAQR3 cdna clone
PAQR3 cDNA Clone
Gene Names
PAQR3; RKTG
Synonyms
PAQR3; PAQR3 cDNA Clone; PAQR3 cdna clone
Sequence
atgcatcagaagctgctgaagagcgcgcattacatcgagctgggcagctaccagtactggccggtcctggtgccccgtggcatccgcctgtacacctacgagcagatccccgggtccctcaaggacaacccgtacatcaccgacggctaccgggcctacctgccgtccaggctgtgtatcaaaagtttgtttattttatctaatgagacagtaaacatctggagtcatttgctgggtttctttctcttcttcaccctgggaatatatgacatgacatctgtgttaccttcagcaagtgcgtccagagaagattttgtaatttgttctatttgtcttttctgcttccaggtctgtatgctttgctctgtgggctatcatcttttttcctgccatcggtcagaaaaaacatgtcgaagatggatggcattagattatgcaggaatttctattggaatactgggctgctatgtctcaggagtattttacgcattttattgtaataactactggcgtcaggtgtacttgatcacagtgcttgctatgatcctggcagtgttctttgcgcagattcatcccaattacctcacgcagcaatggcaaaggctccgttctatcatcttttgttctgtttcgggatatggagtgattcctactcttcactgggtttggctcaatggaggaattggtgctcctattgtacaggactttgcaccccgtgtaattgtgatgtatatgattgctcttcttgctttcctattctacatttccaaagtcccagagcggtactttccagaaaatattttcagatgggaaataactaagaggacactgggtggagtgaacaacagtctccaaaacctgtatttgcttgtttga
Sequence Length
876
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
10,357 Da
NCBI Official Full Name
Homo sapiens progestin and adipoQ receptor family member III, mRNA
NCBI Official Synonym Full Names
progestin and adipoQ receptor family member 3
NCBI Official Symbol
PAQR3
NCBI Official Synonym Symbols
RKTG
NCBI Protein Information
progestin and adipoQ receptor family member 3
UniProt Protein Name
Progestin and adipoQ receptor family member 3
Protein Family
UniProt Gene Name
PAQR3
UniProt Synonym Gene Names
RKTG
UniProt Entry Name
PAQR3_HUMAN
Uniprot Description
PAQR3: Functions as a spatial regulator of RAF1 kinase by sequestrating it to the Golgi. Belongs to the ADIPOR family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Receptor, misc.; Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 4q21.21
Cellular Component: Golgi apparatus; Golgi membrane
Molecular Function: receptor activity
Biological Process: MAPKKK cascade; negative regulation of MAP kinase activity; negative regulation of peptidyl-serine phosphorylation; negative regulation of protein amino acid phosphorylation; protein localization in Golgi apparatus
Research Articles on PAQR3
Similar Products
Product Notes
The PAQR3 paqr3 (Catalog #AAA1268595) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatcaga agctgctgaa gagcgcgcat tacatcgagc tgggcagcta ccagtactgg ccggtcctgg tgccccgtgg catccgcctg tacacctacg agcagatccc cgggtccctc aaggacaacc cgtacatcac cgacggctac cgggcctacc tgccgtccag gctgtgtatc aaaagtttgt ttattttatc taatgagaca gtaaacatct ggagtcattt gctgggtttc tttctcttct tcaccctggg aatatatgac atgacatctg tgttaccttc agcaagtgcg tccagagaag attttgtaat ttgttctatt tgtcttttct gcttccaggt ctgtatgctt tgctctgtgg gctatcatct tttttcctgc catcggtcag aaaaaacatg tcgaagatgg atggcattag attatgcagg aatttctatt ggaatactgg gctgctatgt ctcaggagta ttttacgcat tttattgtaa taactactgg cgtcaggtgt acttgatcac agtgcttgct atgatcctgg cagtgttctt tgcgcagatt catcccaatt acctcacgca gcaatggcaa aggctccgtt ctatcatctt ttgttctgtt tcgggatatg gagtgattcc tactcttcac tgggtttggc tcaatggagg aattggtgct cctattgtac aggactttgc accccgtgta attgtgatgt atatgattgc tcttcttgct ttcctattct acatttccaa agtcccagag cggtactttc cagaaaatat tttcagatgg gaaataacta agaggacact gggtggagtg aacaacagtc tccaaaacct gtatttgctt gtttga. It is sometimes possible for the material contained within the vial of "PAQR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
