Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PAK7 cdna clone

PAK7 cDNA Clone

Gene Names
PAK5; PAK7
Synonyms
PAK7; PAK7 cDNA Clone; PAK7 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttgggaagaaaaagaaaaagattgaaatatctggcccgtccaactttgaacacagggttcatactgggtttgatgcacaagagcagaagtttaccggccttccccagcagtggcacagcctgttagcagatacggccaacaggccaaagcctatggtggacccttcatgcatcacacccatccagctggctcctatgaagacaatcgttagaggaaacaaaccctgcaaggaaacctccatcaacggcctgctagaggattttgacaacatctcggtgactcgctccaactccctaaggaaagaaagcccacccaccccagatcagggagcctccagccacggtccaggccacgcggaagaaaatggcttcatcaccttctcccagtattccagcgaatccgatactactgctgactacacgaccgaaaagtacagggagaagagtctctatggagatgatctggatccgtattatagaggcagccacgcagccaagcaaaatgggcacgtaatgaaaatgaagcacggggaggcctactattctgaggtgaagcctttgaaatccgattttgccagattttctgccgattatcactcacatttggactcactgagcaaaccaagtgaatacagtgacctcaagtgggagtatcagagagcctcgagtagctcccctctggattattcattccaattcacaccttctagaactgcagggaccagcgggtgctccaaggagagcctggcgtacagtgaaagtgaatggggacccagcctggatgactatgacaggaggccaaagtcttcgtacctgaatcagacaagccctcagcccaccatgcggcagaggtccaggtcaggctcgggactccaggaaccgatgatgccatttggagcaagtgcatttaaaacccatccccaaggacactcctacaactcctacacctaccctcgcttgtccgagcccacaatgtgcattccaaaggtggattacgatcgagcacagatggtcctcagccctccactgtcagggtctgacacctaccccaggggccctgccaaactacctcaaagtcaaagcaaatcgggctattcctcaagcagtcaccagtacccgtctgggtaccacaaagccaccttgtaccatcacccctccctgcagagcagttcgcagtacatctccacggcttcctacctgagctacctcagcctctcatccagcacctacccgccgcccagctggggctcctcctccgaccagcagccctccagggtgtcccatgaacagtttcgggcggccctgcagctggtggtcagcccaggagaccccagggaatacttggccaactttatcaaaatcggggaaggctcaaccggcatcgtatgcatcgccaccgagaaacacacagggaaacaagttgcagtgaagaaaatggacctccggaagcaacagagacgagaactgcttttcaatgaggtcgtgatcatgcgggattaccaccatgacaatgtggttgacatgtacagcagctaccttgtcggcgatgagctctgggtggtcatggagtttctagaaggtggtgccttgacagacattgtgactcacaccagaatgaatgaagaacagatagctactgtctgcctgtcagttctgagagctctctcctaccttcataaccaaggagtgattcacagggacataaaaagtgactccatcctcctgacaagcgatggccggataaagttgtctgattttggtttctgtgctcaagtttccaaagaggtgccgaagaggaaatcattggttggcactccctactggatggcccctgaggtgatttctaggctaccttatgggacagaggtggacatctggtccctcgggatcatggtgatagaaatgattgatggcgagcccccctacttcaatgagcctcccctccaggcgatgcggaggatccgggacagtttacctccaagagtgaaggacctacacaaggtttcttcagtgctccggggattcctagacttgatgttggtgagggagccctctcagagagcaacagcccaggaactcctcggacatccattcttaaaactagcaggtccaccgtcttgcattgtccccctcatgagacaatacaggcatcactga
Sequence Length
2160
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,745 Da
NCBI Official Full Name
Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 7, mRNA
NCBI Official Synonym Full Names
p21 (RAC1) activated kinase 5
NCBI Official Symbol
PAK5
NCBI Official Synonym Symbols
PAK7
NCBI Protein Information
serine/threonine-protein kinase PAK 7
UniProt Protein Name
Serine/threonine-protein kinase PAK 7
UniProt Gene Name
PAK7
UniProt Synonym Gene Names
KIAA1264; PAK5; PAK-5; PAK-7
UniProt Entry Name
PAK7_HUMAN

NCBI Description

The protein encoded by this gene is a member of the PAK family of Ser/Thr protein kinases. PAK family members are known to be effectors of Rac/Cdc42 GTPases, which have been implicated in the regulation of cytoskeletal dynamics, proliferation, and cell survival signaling. This kinase contains a CDC42/Rac1 interactive binding (CRIB) motif, and has been shown to bind CDC42 in the presence of GTP. This kinase is predominantly expressed in brain. It is capable of promoting neurite outgrowth, and thus may play a role in neurite development. This kinase is associated with microtubule networks and induces microtubule stabilization. The subcellular localization of this kinase is tightly regulated during cell cycle progression. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

PAK5: a protein kinase of the STE20 family. Predominantly expressed in brain. Capable of promoting neurite outgrowth, and thus may play a role in neurite development. Associated with microtubule networks and induces microtubule stabilization. Its subcellular localization is tightly regulated during cell cycle progression.

Protein type: Kinase, protein; EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); Protein kinase, STE; STE group; STE20 family; PAKB subfamily

Chromosomal Location of Human Ortholog: 20p12

Cellular Component: cytoplasm

Molecular Function: receptor signaling protein serine/threonine kinase activity

Biological Process: apoptosis; cell growth; cell migration; cell proliferation; cytoskeleton organization and biogenesis; mitotic cell cycle; signal transduction

Research Articles on PAK7

Similar Products

Product Notes

The PAK7 pak7 (Catalog #AAA1268108) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttggga agaaaaagaa aaagattgaa atatctggcc cgtccaactt tgaacacagg gttcatactg ggtttgatgc acaagagcag aagtttaccg gccttcccca gcagtggcac agcctgttag cagatacggc caacaggcca aagcctatgg tggacccttc atgcatcaca cccatccagc tggctcctat gaagacaatc gttagaggaa acaaaccctg caaggaaacc tccatcaacg gcctgctaga ggattttgac aacatctcgg tgactcgctc caactcccta aggaaagaaa gcccacccac cccagatcag ggagcctcca gccacggtcc aggccacgcg gaagaaaatg gcttcatcac cttctcccag tattccagcg aatccgatac tactgctgac tacacgaccg aaaagtacag ggagaagagt ctctatggag atgatctgga tccgtattat agaggcagcc acgcagccaa gcaaaatggg cacgtaatga aaatgaagca cggggaggcc tactattctg aggtgaagcc tttgaaatcc gattttgcca gattttctgc cgattatcac tcacatttgg actcactgag caaaccaagt gaatacagtg acctcaagtg ggagtatcag agagcctcga gtagctcccc tctggattat tcattccaat tcacaccttc tagaactgca gggaccagcg ggtgctccaa ggagagcctg gcgtacagtg aaagtgaatg gggacccagc ctggatgact atgacaggag gccaaagtct tcgtacctga atcagacaag ccctcagccc accatgcggc agaggtccag gtcaggctcg ggactccagg aaccgatgat gccatttgga gcaagtgcat ttaaaaccca tccccaagga cactcctaca actcctacac ctaccctcgc ttgtccgagc ccacaatgtg cattccaaag gtggattacg atcgagcaca gatggtcctc agccctccac tgtcagggtc tgacacctac cccaggggcc ctgccaaact acctcaaagt caaagcaaat cgggctattc ctcaagcagt caccagtacc cgtctgggta ccacaaagcc accttgtacc atcacccctc cctgcagagc agttcgcagt acatctccac ggcttcctac ctgagctacc tcagcctctc atccagcacc tacccgccgc ccagctgggg ctcctcctcc gaccagcagc cctccagggt gtcccatgaa cagtttcggg cggccctgca gctggtggtc agcccaggag accccaggga atacttggcc aactttatca aaatcgggga aggctcaacc ggcatcgtat gcatcgccac cgagaaacac acagggaaac aagttgcagt gaagaaaatg gacctccgga agcaacagag acgagaactg cttttcaatg aggtcgtgat catgcgggat taccaccatg acaatgtggt tgacatgtac agcagctacc ttgtcggcga tgagctctgg gtggtcatgg agtttctaga aggtggtgcc ttgacagaca ttgtgactca caccagaatg aatgaagaac agatagctac tgtctgcctg tcagttctga gagctctctc ctaccttcat aaccaaggag tgattcacag ggacataaaa agtgactcca tcctcctgac aagcgatggc cggataaagt tgtctgattt tggtttctgt gctcaagttt ccaaagaggt gccgaagagg aaatcattgg ttggcactcc ctactggatg gcccctgagg tgatttctag gctaccttat gggacagagg tggacatctg gtccctcggg atcatggtga tagaaatgat tgatggcgag cccccctact tcaatgagcc tcccctccag gcgatgcgga ggatccggga cagtttacct ccaagagtga aggacctaca caaggtttct tcagtgctcc ggggattcct agacttgatg ttggtgaggg agccctctca gagagcaaca gcccaggaac tcctcggaca tccattctta aaactagcag gtccaccgtc ttgcattgtc cccctcatga gacaatacag gcatcactga. It is sometimes possible for the material contained within the vial of "PAK7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.