Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PAH cdna clone

PAH cDNA Clone

Gene Names
PAH; PH; PKU; PKU1
Synonyms
PAH; PAH cDNA Clone; PAH cdna clone
Ordering
For Research Use Only!
Sequence
atgtccactgcggtcctggaaaacccaggcttgggcaggaaactctctgactttggacaggaaacaagctatattgaagacaactgcaatcaaaatggtgccatatcgctgatcttctcactcaaagaagaagttggtgcattggccaaagtattgcgcttatttgaggagaatgatgtaaacctgacccacattgaatctagaccttctcgtttaaagaaagatgagtatgaatttttcacccatttggataaacgtagcctgcctgctctgacaaacatcatcaagatcttgaggcatgacattggtgccactgtccatgagctttcacgagataagaagaaagacacagtgccctggttcccaagaaccattcaagagctggacagatttgccaatcagattctcagctatggagcggaactggatgctgaccaccctggttttaaagatcctgtgtaccgtgcaagacggaagcagtttgctgacattgcctacaactaccgccatgggcagcccatccctcgagtggaatacatggaggaaggaaagaaaacatggggcacagtgttcaagactctgaagtccttgtataaaacccatgcttgctatgagtacaatcacatttttccacttcttgaaaagtactgtggcttccatgaagataacattccccagctggaagacgtttctcagttcctgcagacttgcactggtttccgcctccgacctgtggctggcctgctttcctctcgggatttcttgggtggcctggccttccgagtcttccactgcacacagtacatcagacatggatccaagcccatgtatacccccgaacctgacatctgccatgagctgttgggacatgtgcccttgttttcagatcgcagctttgcccagttttcccaggaaattggccttgcctctctgggtgcacctgatgaatacattgaaaagctcgccacaatttactggtttactgtggagtttgggctctgcaaacaaggagactccataaaggcatatggtgctgggctcctgtcatcctttggtgaattacagtactgcttatcagagaagccaaagcttctccccctggagctggagaagacagccatccaaaattacactgtcacggagttccagcccctctattacgtggcagagagttttaatgatgccaaggagaaagtaaggaactttgctgccacaatacctcggcccttctcagttcgctacgacccatacacccaaaggattgaggtcttggacaatacccagcagcttaagattttggctgattccattaacagtgaaattggaatcctttgcagtgccctccagaaaataaagtaa
Sequence Length
1359
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,862 Da
NCBI Official Full Name
Homo sapiens phenylalanine hydroxylase, mRNA
NCBI Official Synonym Full Names
phenylalanine hydroxylase
NCBI Official Symbol
PAH
NCBI Official Synonym Symbols
PH; PKU; PKU1
NCBI Protein Information
phenylalanine-4-hydroxylase
UniProt Protein Name
Phenylalanine-4-hydroxylase
UniProt Gene Name
PAH
UniProt Synonym Gene Names
PAH
UniProt Entry Name
PH4H_HUMAN

NCBI Description

PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]

Uniprot Description

PAH: phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Belongs to the biopterin-dependent aromatic amino acid hydroxylase family. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria.

Protein type: Oxidoreductase; Amino Acid Metabolism - phenylalanine, tyrosine and tryptophan biosynthesis; EC 1.14.16.1

Chromosomal Location of Human Ortholog: 12q22-q24.2

Cellular Component: cytosol

Molecular Function: phenylalanine 4-monooxygenase activity

Biological Process: amino acid biosynthetic process; L-phenylalanine catabolic process

Disease: Phenylketonuria

Research Articles on PAH

Similar Products

Product Notes

The PAH pah (Catalog #AAA1275791) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccactg cggtcctgga aaacccaggc ttgggcagga aactctctga ctttggacag gaaacaagct atattgaaga caactgcaat caaaatggtg ccatatcgct gatcttctca ctcaaagaag aagttggtgc attggccaaa gtattgcgct tatttgagga gaatgatgta aacctgaccc acattgaatc tagaccttct cgtttaaaga aagatgagta tgaatttttc acccatttgg ataaacgtag cctgcctgct ctgacaaaca tcatcaagat cttgaggcat gacattggtg ccactgtcca tgagctttca cgagataaga agaaagacac agtgccctgg ttcccaagaa ccattcaaga gctggacaga tttgccaatc agattctcag ctatggagcg gaactggatg ctgaccaccc tggttttaaa gatcctgtgt accgtgcaag acggaagcag tttgctgaca ttgcctacaa ctaccgccat gggcagccca tccctcgagt ggaatacatg gaggaaggaa agaaaacatg gggcacagtg ttcaagactc tgaagtcctt gtataaaacc catgcttgct atgagtacaa tcacattttt ccacttcttg aaaagtactg tggcttccat gaagataaca ttccccagct ggaagacgtt tctcagttcc tgcagacttg cactggtttc cgcctccgac ctgtggctgg cctgctttcc tctcgggatt tcttgggtgg cctggccttc cgagtcttcc actgcacaca gtacatcaga catggatcca agcccatgta tacccccgaa cctgacatct gccatgagct gttgggacat gtgcccttgt tttcagatcg cagctttgcc cagttttccc aggaaattgg ccttgcctct ctgggtgcac ctgatgaata cattgaaaag ctcgccacaa tttactggtt tactgtggag tttgggctct gcaaacaagg agactccata aaggcatatg gtgctgggct cctgtcatcc tttggtgaat tacagtactg cttatcagag aagccaaagc ttctccccct ggagctggag aagacagcca tccaaaatta cactgtcacg gagttccagc ccctctatta cgtggcagag agttttaatg atgccaagga gaaagtaagg aactttgctg ccacaatacc tcggcccttc tcagttcgct acgacccata cacccaaagg attgaggtct tggacaatac ccagcagctt aagattttgg ctgattccat taacagtgaa attggaatcc tttgcagtgc cctccagaaa ataaagtaa. It is sometimes possible for the material contained within the vial of "PAH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.