Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PAF1 cdna clone

PAF1 cDNA Clone

Gene Names
PAF1; PD2; F23149_1
Synonyms
PAF1; PAF1 cDNA Clone; PAF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcccaccatccagacccaggcccagcgggaggatggccacaggcccaattcccaccggactctgcctgagaggtctggagtggtctgccgagtcaagtactgcaatagcctccctgatatccccttcgaccccaagttcatcacctaccccttcgaccagaacaggttcgtccagtacaaagccacttccttggagaaacagcacaaacatgacctcctgactgagccagacctgggggtcaccatcgatctcatcaatcctgacacctaccgcatcgaccccaatgttcttctagatccagctgatgagaaacttttggaagaggagattcaggcccccaccagctccaagagatcccagcagcacgcgaaggtggtgccatggatgcgaaagacagagtacatctccactgagttcaaccgttatggcatctccaatgagaagcctgaggtcaagattggggtttctgtgaagcagcagtttaccgaggaagaaatatacaaagacagggatagccagatcacagccattgagaagacttttgaggatgcccagaaatcaatctcacagcattacagcaaaccccgagtcacaccggtggaggtcatgcctgtcttcccagactttaagatgtggatcaatccatgtgctcaggtgatctttgactcagacccagcccccaaggacacgagtggtgcagctgcgttggagatgatgtctcaggccatgattaggggcatgatggatgaggaagggaaccagtttgtggcctatttcctgcctgtagaagagacgttgaagaaacgaaagcgggaccaggaggaggagatggactatgcaccagatgatgtgtatgactacaaaattgctcgggagtacaactggaacgtgaagaacaaagctagcaagggctatgaggaaaactacttcttcatcttccgagagggtgacggggtttactacaatgagttggaaaccagggtccgccttagtaagcgccgggccaaggctggggttcagtcaggcaccaacgccctgcttgtggtcaaacatcgggacatgaatgagaaggaactggaagctcaggaggcacggaaggcccagctagaaaaccacgaaccggaggaggaagaggaagaggagatggagacagaagagaaagaagctgggggctcagatgaggagcaggagaagggcagcagcagtgagaaggagggcagtgaagatgagcactcgggcagcgagagtgaacgggaggaaggtgacagggacgaggccagtgacaagagtggcagtggtgaggacgagagcagcgaggatgaggcccgggctgcccgtgacaaagaggagatctttggcagtgatgctgattctgaggacgatgccgactctgatgatgaggacagaggacaggcccaaggtggcagtgacaatgattcagacagcggcagcaatgggggtggccagcggagccggagccacagccgcagcgccagtcccttccccagtggcagcgagcactcggcccaggaggatggcagtgaagctgcagcttctgattccagtgaagctgatagtgacagtgactga
Sequence Length
1596
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,473 Da
NCBI Official Full Name
Homo sapiens Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
PAF1 homolog, Paf1/RNA polymerase II complex component
NCBI Official Symbol
PAF1
NCBI Official Synonym Symbols
PD2; F23149_1
NCBI Protein Information
RNA polymerase II-associated factor 1 homolog
UniProt Protein Name
RNA polymerase II-associated factor 1 homolog
Protein Family
UniProt Gene Name
PAF1
UniProt Synonym Gene Names
PD2; hPAF1
UniProt Entry Name
PAF1_HUMAN

NCBI Description

This gene encodes a subunit of the polymerase associated factor (PAF1) complex. The PAF1 complex interacts with RNA polymerase II and plays a role in transcription elongation as well as histone modifications including ubiquitylation and methylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]

Uniprot Description

PAF1: Component of the PAF1 complex (PAF1C) which has multiple functions during transcription by RNA polymerase II and is implicated in regulation of development and maintenance of embryonic stem cell pluripotency. PAF1C associates with RNA polymerase II through interaction with POLR2A CTD non- phosphorylated and 'Ser-2'- and 'Ser-5'-phosphorylated forms and is involved in transcriptional elongation, acting both indepentently and synergistically with TCEA1 and in cooperation with the DSIF complex and HTATSF1. PAF1C is required for transcription of Hox and Wnt target genes. PAF1C is involved in hematopoiesis and stimulates transcriptional activity of MLL1; it promotes leukemogenesis though association with MLL-rearranged oncoproteins, such as MLL-MLLT3/AF9 and MLL-MLLT1/ENL. PAF1C is involved in histone modifications such as ubiquitination of histone H2B and methylation on histone H3 'Lys-4' (H3K4me3). PAF1C recruits the RNF20/40 E3 ubiquitin-protein ligase complex and the E2 enzyme UBE2A or UBE2B to chromatin which mediate monoubiquitination of 'Lys-120' of histone H2B (H2BK120ub1); UB2A/B-mediated H2B ubiquitination is proposed to be coupled to transcription. PAF1C is involved in mRNA 3' end formation probably through association with cleavage and poly(A) factors. In case of infection by influenza A strain H3N2, PAF1C associates with viral NS1 protein, thereby regulating gene transcription. Connects PAF1C with the RNF20/40 E3 ubiquitin-protein ligase complex. Involved in polyadenylation of mRNA precursors. Has oncogenic activity in vivo and in vitro. Belongs to the PAF1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor; Transcription regulation

Chromosomal Location of Human Ortholog: 19q13.1

Cellular Component: cell junction; cytoplasm; membrane; nucleoplasm

Molecular Function: protein binding

Biological Process: endodermal cell fate commitment; histone H2B ubiquitination; histone monoubiquitination; mRNA polyadenylation; negative regulation of myeloid cell differentiation; negative regulation of transcription from RNA polymerase II promoter; nucleosome positioning; positive regulation of histone methylation; positive regulation of mRNA 3'-end processing; positive regulation of RNA elongation from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter

Research Articles on PAF1

Similar Products

Product Notes

The PAF1 paf1 (Catalog #AAA1266912) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccca ccatccagac ccaggcccag cgggaggatg gccacaggcc caattcccac cggactctgc ctgagaggtc tggagtggtc tgccgagtca agtactgcaa tagcctccct gatatcccct tcgaccccaa gttcatcacc taccccttcg accagaacag gttcgtccag tacaaagcca cttccttgga gaaacagcac aaacatgacc tcctgactga gccagacctg ggggtcacca tcgatctcat caatcctgac acctaccgca tcgaccccaa tgttcttcta gatccagctg atgagaaact tttggaagag gagattcagg cccccaccag ctccaagaga tcccagcagc acgcgaaggt ggtgccatgg atgcgaaaga cagagtacat ctccactgag ttcaaccgtt atggcatctc caatgagaag cctgaggtca agattggggt ttctgtgaag cagcagttta ccgaggaaga aatatacaaa gacagggata gccagatcac agccattgag aagacttttg aggatgccca gaaatcaatc tcacagcatt acagcaaacc ccgagtcaca ccggtggagg tcatgcctgt cttcccagac tttaagatgt ggatcaatcc atgtgctcag gtgatctttg actcagaccc agcccccaag gacacgagtg gtgcagctgc gttggagatg atgtctcagg ccatgattag gggcatgatg gatgaggaag ggaaccagtt tgtggcctat ttcctgcctg tagaagagac gttgaagaaa cgaaagcggg accaggagga ggagatggac tatgcaccag atgatgtgta tgactacaaa attgctcggg agtacaactg gaacgtgaag aacaaagcta gcaagggcta tgaggaaaac tacttcttca tcttccgaga gggtgacggg gtttactaca atgagttgga aaccagggtc cgccttagta agcgccgggc caaggctggg gttcagtcag gcaccaacgc cctgcttgtg gtcaaacatc gggacatgaa tgagaaggaa ctggaagctc aggaggcacg gaaggcccag ctagaaaacc acgaaccgga ggaggaagag gaagaggaga tggagacaga agagaaagaa gctgggggct cagatgagga gcaggagaag ggcagcagca gtgagaagga gggcagtgaa gatgagcact cgggcagcga gagtgaacgg gaggaaggtg acagggacga ggccagtgac aagagtggca gtggtgagga cgagagcagc gaggatgagg cccgggctgc ccgtgacaaa gaggagatct ttggcagtga tgctgattct gaggacgatg ccgactctga tgatgaggac agaggacagg cccaaggtgg cagtgacaat gattcagaca gcggcagcaa tgggggtggc cagcggagcc ggagccacag ccgcagcgcc agtcccttcc ccagtggcag cgagcactcg gcccaggagg atggcagtga agctgcagct tctgattcca gtgaagctga tagtgacagt gactga. It is sometimes possible for the material contained within the vial of "PAF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.