PABPC5 cdna clone
PABPC5 cDNA Clone
Gene Names
PABPC5; PABP5
Synonyms
PABPC5; PABPC5 cDNA Clone; PABPC5 cdna clone
Sequence
atggggagcggggagcctaatcctgctggcaagaaaaagaagtatctcaaggccgctctgtacgtgggtgacttggacccagatgtcaccgaggacatgctctataagaagttcaggcctgctggccctctgcgattcacccgaatctgccgtgatccggtgacccgcagccccctgggctatgggtatgttaacttccgctttcccgcggatgcagagtgggccttgaacaccatgaattttgatttgattaatggaaaaccattccgccttatgtggtctcagccagatgaccgcttaagaaagtctggagtgggaaatatattcatcaaaaacctggacaaatccatagacaatagggccctgttttacttattttctgcttttgggaacattctgtcctgcaaagtcgtatgcgatgacaacggctctaagggttatgcctatgttcactttgacagcctggccgctgccaatagagccatctggcacatgaatggagtgcggctcaacaaccgccaggtgtatgttggcagattcaaattcccagaagagcgggcggctgaggtcagaaccagggatagagcaactttcaccaatgttttcgttaaaaacattggagacgacatagatgacgaaaaactgaaggaacttttctgtgaatatgggccaactgagagtgttaaagtaataagagatgccagtgggaaatctaaaggctttggatttgtgagatatgagacacacgaggctgcccaaaaggctgtgctagacttgcatggaaagtccatcgatggaaaagtcctctatgtagggcgagcacagaagaaaattgaacgcctggctgagttgaggcggagatttgaacggctgaggttaaaagaaaaaagtcggcccccaggggtgcctatctatattaagaacttggatgagacaatcaatgatgaaaaactgaaggaggaattttcttcctttgggtcaattagtcgggccaaagtgatgatggaagtggggcaaggcaaaggatttggtgtggtctgcttttcctcttttgaagaggctaccaaagcagtggatgagatgaatggccgcatagtgggctccaagcccctgcatgtcaccctgggccaggccaggcgcaggtgctga
Sequence Length
1149
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,941 Da
NCBI Official Full Name
Homo sapiens poly(A) binding protein, cytoplasmic 5, mRNA
NCBI Official Synonym Full Names
poly(A) binding protein cytoplasmic 5
NCBI Official Symbol
PABPC5
NCBI Official Synonym Symbols
PABP5
NCBI Protein Information
polyadenylate-binding protein 5
UniProt Protein Name
Polyadenylate-binding protein 5
Protein Family
UniProt Gene Name
PABPC5
UniProt Synonym Gene Names
PABP5; PABP-5; Poly(A)-binding protein 5
UniProt Entry Name
PABP5_HUMAN
NCBI Description
This gene encodes a protein that binds to the polyA tail found at the 3' end of most eukaryotic mRNAs. It is thought to play a role in the regulation of mRNA metabolic processes in the cytoplasm. This gene is located in a gene-poor region within the X-specific 13d-sY43 subinterval of the chromosome Xq21.3/Yp11.2 homology block. It is located close to translocation breakpoints associated with premature ovarian failure, and is therefore a potential candidate gene for this disorder. [provided by RefSeq, May 2010]
Uniprot Description
PABPC5: Binds the poly(A) tail of mRNA. May be involved in cytoplasmic regulatory processes of mRNA metabolism. Can probably bind to cytoplasmic RNA sequences other than poly(A) in vivo.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: Xq21.3
Research Articles on PABPC5
Similar Products
Product Notes
The PABPC5 pabpc5 (Catalog #AAA1267641) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggagcg gggagcctaa tcctgctggc aagaaaaaga agtatctcaa ggccgctctg tacgtgggtg acttggaccc agatgtcacc gaggacatgc tctataagaa gttcaggcct gctggccctc tgcgattcac ccgaatctgc cgtgatccgg tgacccgcag ccccctgggc tatgggtatg ttaacttccg ctttcccgcg gatgcagagt gggccttgaa caccatgaat tttgatttga ttaatggaaa accattccgc cttatgtggt ctcagccaga tgaccgctta agaaagtctg gagtgggaaa tatattcatc aaaaacctgg acaaatccat agacaatagg gccctgtttt acttattttc tgcttttggg aacattctgt cctgcaaagt cgtatgcgat gacaacggct ctaagggtta tgcctatgtt cactttgaca gcctggccgc tgccaataga gccatctggc acatgaatgg agtgcggctc aacaaccgcc aggtgtatgt tggcagattc aaattcccag aagagcgggc ggctgaggtc agaaccaggg atagagcaac tttcaccaat gttttcgtta aaaacattgg agacgacata gatgacgaaa aactgaagga acttttctgt gaatatgggc caactgagag tgttaaagta ataagagatg ccagtgggaa atctaaaggc tttggatttg tgagatatga gacacacgag gctgcccaaa aggctgtgct agacttgcat ggaaagtcca tcgatggaaa agtcctctat gtagggcgag cacagaagaa aattgaacgc ctggctgagt tgaggcggag atttgaacgg ctgaggttaa aagaaaaaag tcggccccca ggggtgccta tctatattaa gaacttggat gagacaatca atgatgaaaa actgaaggag gaattttctt cctttgggtc aattagtcgg gccaaagtga tgatggaagt ggggcaaggc aaaggatttg gtgtggtctg cttttcctct tttgaagagg ctaccaaagc agtggatgag atgaatggcc gcatagtggg ctccaagccc ctgcatgtca ccctgggcca ggccaggcgc aggtgctga. It is sometimes possible for the material contained within the vial of "PABPC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
