Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PA2G4 cdna clone

PA2G4 cDNA Clone

Gene Names
PA2G4; EBP1; HG4-1; p38-2G4
Synonyms
PA2G4; PA2G4 cDNA Clone; PA2G4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgggcgaggacgagcaacaggagcaaactatcgctgaggacctggtcgtgaccaagtataagatggggggcgacatcgccaacagggtacttcggtccttggtggaagcatctagctcaggtgtgtcggtactgagcctgtgtgagaaaggtgatgccatgattatggaagaaacagggaaaatcttcaagaaagaaaaggaaatgaagaaaggtattgcttttcccaccagcatttcggtaaataactgtgtatgtcacttctcccctttgaagagcgaccaggattatattctcaaggaaggtgacttggtaaaaattgaccttggggtccatgtggatggcttcatcgctaatgtagctcacacttttgtggttgatgtagctcaggggacccaagtaacagggaggaaagcagatgttattaaggcagctcacctttgtgctgaagctgccctacgcctggtcaaacctggaaatcagaacacacaagtgacagaagcctggaacaaagttgcccactcatttaactgcacgccaatagaaggtatgctgtcacaccagttgaagcagcatgtcatcgatggagaaaaaaccattatccagaatcccacagaccagcagaagaaggaccatgaaaaagctgaatttgaggtacatgaagtatatgctgtggatgttctcgtcagctcaggagagggcaaggccaaggatgcaggacagagaaccactatttacaaacgagacccctctaaacagtatggactgaaaatgaaaacttcacgtgccttcttcagtgaggtggaaaggcgttttgatgccatgccgtttactttaagagcatttgaagatgagaagaaggctcggatgggtgtggtggagtgcgccaaacatgaactgctgcaaccatttaatgttctctatgagaaggagggtgaatttgttgcccagtttaaatttacagttctgctcatgcccaatggccccatgcggataaccagtggtcccttcgagcctgacctctacaagtctgagatggaggtccaggatgcagagctaaaggccctcctccagagttctgcaagtcgaaaaacccagaaaaagaaaaaaaagaaggcctccaagactgcagagaatgccaccagtggggaaacattagaagaaaatgaagctggggactga
Sequence Length
1185
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,059 Da
NCBI Official Full Name
Homo sapiens proliferation-associated 2G4, 38kDa, mRNA
NCBI Official Synonym Full Names
proliferation-associated 2G4
NCBI Official Symbol
PA2G4
NCBI Official Synonym Symbols
EBP1; HG4-1; p38-2G4
NCBI Protein Information
proliferation-associated protein 2G4
UniProt Protein Name
Proliferation-associated protein 2G4
UniProt Gene Name
PA2G4
UniProt Synonym Gene Names
EBP1; hG4-1
UniProt Entry Name
PA2G4_HUMAN

NCBI Description

This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

Ebp1: May play a role in a ERBB3-regulated signal transduction pathway. Seems be involved in growth regulation. Acts a corepressor of the androgen receptor (AR) and is regulated by the ERBB3 ligand neuregulin-1/heregulin (HRG). Inhibits transcription of some E2F1-regulated promoters, probably by recruiting histone acetylase (HAT) activity. Binds RNA. Associates with 28S, 18S and 5.8S mature rRNAs, several rRNA precursors and probably U3 small nucleolar RNA. May be involved in regulation of intermediate and late steps of rRNA processing. May be involved in ribosome assembly. Mediates cap-independent translation of specific viral IRESs (internal ribosomal entry site). Belongs to the peptidase M24 family.

Protein type: Nuclear receptor co-regulator; Nucleolus; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 12q13.2

Cellular Component: cytoplasm; membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: DNA binding; protein binding; transcription factor activity; ubiquitin protein ligase binding

Biological Process: cell cycle arrest; cell proliferation; negative regulation of apoptosis; negative regulation of transcription, DNA-dependent; positive regulation of cell differentiation

Research Articles on PA2G4

Similar Products

Product Notes

The PA2G4 pa2g4 (Catalog #AAA1268327) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgggcg aggacgagca acaggagcaa actatcgctg aggacctggt cgtgaccaag tataagatgg ggggcgacat cgccaacagg gtacttcggt ccttggtgga agcatctagc tcaggtgtgt cggtactgag cctgtgtgag aaaggtgatg ccatgattat ggaagaaaca gggaaaatct tcaagaaaga aaaggaaatg aagaaaggta ttgcttttcc caccagcatt tcggtaaata actgtgtatg tcacttctcc cctttgaaga gcgaccagga ttatattctc aaggaaggtg acttggtaaa aattgacctt ggggtccatg tggatggctt catcgctaat gtagctcaca cttttgtggt tgatgtagct caggggaccc aagtaacagg gaggaaagca gatgttatta aggcagctca cctttgtgct gaagctgccc tacgcctggt caaacctgga aatcagaaca cacaagtgac agaagcctgg aacaaagttg cccactcatt taactgcacg ccaatagaag gtatgctgtc acaccagttg aagcagcatg tcatcgatgg agaaaaaacc attatccaga atcccacaga ccagcagaag aaggaccatg aaaaagctga atttgaggta catgaagtat atgctgtgga tgttctcgtc agctcaggag agggcaaggc caaggatgca ggacagagaa ccactattta caaacgagac ccctctaaac agtatggact gaaaatgaaa acttcacgtg ccttcttcag tgaggtggaa aggcgttttg atgccatgcc gtttacttta agagcatttg aagatgagaa gaaggctcgg atgggtgtgg tggagtgcgc caaacatgaa ctgctgcaac catttaatgt tctctatgag aaggagggtg aatttgttgc ccagtttaaa tttacagttc tgctcatgcc caatggcccc atgcggataa ccagtggtcc cttcgagcct gacctctaca agtctgagat ggaggtccag gatgcagagc taaaggccct cctccagagt tctgcaagtc gaaaaaccca gaaaaagaaa aaaaagaagg cctccaagac tgcagagaat gccaccagtg gggaaacatt agaagaaaat gaagctgggg actga. It is sometimes possible for the material contained within the vial of "PA2G4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.