Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

P4HB cdna clone

P4HB cDNA Clone

Gene Names
P4HB; DSI; GIT; PDI; PHDB; PDIA1; PO4DB; PO4HB; PROHB; CLCRP1; ERBA2L; P4Hbeta
Synonyms
P4HB; P4HB cDNA Clone; P4HB cdna clone
Ordering
For Research Use Only!
Sequence
atgaccaagtacaagcccgaatcggaggagctgacggcagagtggatcacagagttctgccaccgcttcctggagggcaaaatcaagccccacctgatgagccaggagctgccggaggactgggacaagcagcctgtcaaggtgcttgttgggaagaactttgaagacgtggcttttgatgagaaaaaaaacgtctttgtggagttctatgccccatggtgtggtcactgcaaacagttggctcccatttgggataaactgggagagacgtacaaggaccatgagaacatcgtcatcgccaagatggactcgactgccaacgaggtggaggccgtcaaagtgcacagcttccccacactcaagttctttcctgccagtgccgacaggacggtcatcgattacaacggggaacgcacgctggatggttttaagaaattcctggagagcggtggccaggatggggcaggggatgatgacgatctcgaggacctggaagaagcagaggagccagacatggaggaagacgatgatcagaaagctgtgaaagatgaactgtaa
Sequence Length
558
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,116 Da
NCBI Official Full Name
Homo sapiens prolyl 4-hydroxylase, beta polypeptide, mRNA
NCBI Official Synonym Full Names
prolyl 4-hydroxylase subunit beta
NCBI Official Symbol
P4HB
NCBI Official Synonym Symbols
DSI; GIT; PDI; PHDB; PDIA1; PO4DB; PO4HB; PROHB; CLCRP1; ERBA2L; P4Hbeta
NCBI Protein Information
protein disulfide-isomerase
UniProt Protein Name
Protein disulfide-isomerase
UniProt Gene Name
P4HB
UniProt Synonym Gene Names
ERBA2L; PDI; PDIA1; PO4DB; PDI
UniProt Entry Name
PDIA1_HUMAN

NCBI Description

This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]

Uniprot Description

PDIA1: This multifunctional protein catalyzes the formation, breakage and rearrangement of disulfide bonds. At the cell surface, seems to act as a reductase that cleaves disulfide bonds of proteins attached to the cell. May therefore cause structural modifications of exofacial proteins. Inside the cell, seems to form/rearrange disulfide bonds of nascent proteins. At high concentrations, functions as a chaperone that inhibits aggregation of misfolded proteins. At low concentrations, facilitates aggregation (anti-chaperone activity). May be involved with other chaperones in the structural modification of the TG precursor in hormone biogenesis. Also acts a structural subunit of various enzymes such as prolyl 4-hydroxylase and microsomal triacylglycerol transfer protein MTTP. Homodimer. Monomers and homotetramers may also occur. Also constitutes the structural subunit of prolyl 4-hydroxylase and of the microsomal triacylglycerol transfer protein MTTP in mammalian cells. Stabilizes both enzymes and retain them in the ER without contributing to the catalytic activity. Binds UBQLN1. Binds to CD4, and upon HIV-1 binding to the cell membrane, is part of a P4HB/PDI-CD4-CXCR4-gp120 complex. Belongs to the protein disulfide isomerase family.

Protein type: EC 5.3.4.1; Endoplasmic reticulum; Isomerase; Nuclear receptor co-regulator; Oxidoreductase

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; ER-Golgi intermediate compartment; external side of plasma membrane; extracellular matrix; focal adhesion

Molecular Function: integrin binding; procollagen-proline 4-dioxygenase activity; protein binding; protein disulfide isomerase activity; protein heterodimerization activity

Biological Process: lipoprotein biosynthetic process; peptidyl-proline hydroxylation to 4-hydroxy-L-proline; positive regulation of virion penetration into host cell; response to reactive oxygen species

Disease: Cole-carpenter Syndrome 1

Research Articles on P4HB

Similar Products

Product Notes

The P4HB p4hb (Catalog #AAA1274998) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccaagt acaagcccga atcggaggag ctgacggcag agtggatcac agagttctgc caccgcttcc tggagggcaa aatcaagccc cacctgatga gccaggagct gccggaggac tgggacaagc agcctgtcaa ggtgcttgtt gggaagaact ttgaagacgt ggcttttgat gagaaaaaaa acgtctttgt ggagttctat gccccatggt gtggtcactg caaacagttg gctcccattt gggataaact gggagagacg tacaaggacc atgagaacat cgtcatcgcc aagatggact cgactgccaa cgaggtggag gccgtcaaag tgcacagctt ccccacactc aagttctttc ctgccagtgc cgacaggacg gtcatcgatt acaacgggga acgcacgctg gatggtttta agaaattcct ggagagcggt ggccaggatg gggcagggga tgatgacgat ctcgaggacc tggaagaagc agaggagcca gacatggagg aagacgatga tcagaaagct gtgaaagatg aactgtaa. It is sometimes possible for the material contained within the vial of "P4HB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.