P2RY10 cdna clone
P2RY10 cDNA Clone
Gene Names
P2RY10; P2Y10; LYPSR2
Synonyms
P2RY10; P2RY10 cDNA Clone; P2RY10 cdna clone
Sequence
atggctaaccttgacaaatacactgaaacattcaagatgggtagcaacagtaccagcactgctgagatttactgtaatgtcactaatgtgaaatttcaatactccctctatgcaaccacctatatcctcatattcattcctggtcttctggctaacagtgcagccttgtgggttctgtgccgcttcatcagcaagaaaaataaagccatcattttcatgatcaacctctctgtggctgaccttgctcatgtattatctttacccctccggatttactattacatcagccaccactggcctttccagagagccctttgcctgctctgcttctacctgaagtatctcaacatgtatgccagcatttgtttcctgacgtgcatcagtcttcaaaggtgcttttttctcctcaagcccttcagggccagagactggaagcgtaggtacgatgtgggcatcagtgctgccatctggatcgttgtggggactgcctgtttgccatttcccatcctgagaagcacagacttaaacaacaacaagtcctgctttgctgatcttggatacaagcaaatgaatgcagttgcgttggtcgggatgattacagttgctgagcttgcaggatttgtgatcccagtgatcatcatcgcatggtgtacctggaaaactactatatccttgagacagccaccaatggctttccaagggatcagtgagaggcagaaagcactgcggatggtgttcatgtgtgctgcagtcttcttcatctgcttcactccctatcatattaactttattttttacaccatggtaaaggaaaccatcattagcagttgtcccgttgtccgaatcgcactgtatttccaccctttttgcctgtgccttgcaagtctctgctgccttttggatccaattctttattactttatggcttcagagtttcgtgaccaactatcccgccatggcagttctgtgacccgctcccgcctcatgagcaaggagagtggttcatcaatgattggctaa
Sequence Length
1020
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,774 Da
NCBI Official Full Name
Homo sapiens purinergic receptor P2Y, G-protein coupled, 10, mRNA
NCBI Official Synonym Full Names
purinergic receptor P2Y10
NCBI Official Symbol
P2RY10
NCBI Official Synonym Symbols
P2Y10; LYPSR2
NCBI Protein Information
putative P2Y purinoceptor 10
UniProt Protein Name
Putative P2Y purinoceptor 10
Protein Family
UniProt Gene Name
P2RY10
UniProt Synonym Gene Names
P2Y10
UniProt Entry Name
P2Y10_HUMAN
NCBI Description
The protein encoded by this gene belongs to the family of G-protein coupled receptors that are preferentially activated by adenosine and uridine nucleotides. There is a pseudogene for this gene nearby on chromosome X. Multiple alternatively spliced transcripts have been observed. [provided by RefSeq, Apr 2016]
Uniprot Description
P2RY10: Putative receptor for purines coupled to G-proteins. Belongs to the G-protein coupled receptor 1 family.
Protein type: Membrane protein, multi-pass; GPCR, family 1; Receptor, GPCR; Membrane protein, integral
Chromosomal Location of Human Ortholog: Xq21.1
Cellular Component: plasma membrane
Research Articles on P2RY10
Similar Products
Product Notes
The P2RY10 p2ry10 (Catalog #AAA1270969) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaacc ttgacaaata cactgaaaca ttcaagatgg gtagcaacag taccagcact gctgagattt actgtaatgt cactaatgtg aaatttcaat actccctcta tgcaaccacc tatatcctca tattcattcc tggtcttctg gctaacagtg cagccttgtg ggttctgtgc cgcttcatca gcaagaaaaa taaagccatc attttcatga tcaacctctc tgtggctgac cttgctcatg tattatcttt acccctccgg atttactatt acatcagcca ccactggcct ttccagagag ccctttgcct gctctgcttc tacctgaagt atctcaacat gtatgccagc atttgtttcc tgacgtgcat cagtcttcaa aggtgctttt ttctcctcaa gcccttcagg gccagagact ggaagcgtag gtacgatgtg ggcatcagtg ctgccatctg gatcgttgtg gggactgcct gtttgccatt tcccatcctg agaagcacag acttaaacaa caacaagtcc tgctttgctg atcttggata caagcaaatg aatgcagttg cgttggtcgg gatgattaca gttgctgagc ttgcaggatt tgtgatccca gtgatcatca tcgcatggtg tacctggaaa actactatat ccttgagaca gccaccaatg gctttccaag ggatcagtga gaggcagaaa gcactgcgga tggtgttcat gtgtgctgca gtcttcttca tctgcttcac tccctatcat attaacttta ttttttacac catggtaaag gaaaccatca ttagcagttg tcccgttgtc cgaatcgcac tgtatttcca ccctttttgc ctgtgccttg caagtctctg ctgccttttg gatccaattc tttattactt tatggcttca gagtttcgtg accaactatc ccgccatggc agttctgtga cccgctcccg cctcatgagc aaggagagtg gttcatcaat gattggctaa. It is sometimes possible for the material contained within the vial of "P2RY10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
