Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

P2RX1 cdna clone

P2RX1 cDNA Clone

Gene Names
P2RX1; P2X1
Synonyms
P2RX1; P2RX1 cDNA Clone; P2RX1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcgagcggcctcatcagcagtgtctctgtgaaactcaagggcctggccgtgacccagctccctggcctcggcccccaggtctgggatgtggctgactacgtcttcccagcccagggggacaactccttcgtggtcatgaccaatttcatcgtgaccccgaagcagactcaaggctactgcgcagagcacccagaagggggcatatgcaaggaagacagtggctgtacccctgggaaggccaagaggaaggcccaaggcatccgcacgggcaagtgtgtggccttcaacgacactgtgaagacgtgtgagatctttggctggtgccccgtggaggtggatgacgacatcccgcgccctgcccttctccgagaggccgagaacttcactcttttcatcaagaacagcatcagctttccacgcttcaaggtcaacaggcgcaacctggtggaggaggtgaatgctgcccacatgaagacctgcctctttcacaagaccctgcaccccctgtgcccagtcttccagcttggctacgtggtgcaagagtcaggccagaacttcagcaccctggctgagaagggtggagtggttggcatcaccatcgactggcactgtgacctggactggcacgtacggcactgcagacccatctatgagttccatgggctgtacgaagagaaaaatctctccccaggcttcaacttcaggtttgccaggcactttgtggagaacgggaccaactaccgtcacctcttcaaggtgtttgggattcgctttgacatcctggtggacggcaaggccgggaagtttgacatcatccctacaatgaccaccatcggctctggaattggcatctttggggtggccacagttctctgtgacctgctgctgcttcacatcctgcctaagaggcactactacaagcagaagaagttcaaatacgctgaggacatggggccaggggcggctgagcgtgacctcgcagctaccagctccaccctgggcctgcaggagaacatgaggacatcctga
Sequence Length
1200
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,980 Da
NCBI Official Full Name
Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1, mRNA
NCBI Official Synonym Full Names
purinergic receptor P2X 1
NCBI Official Symbol
P2RX1
NCBI Official Synonym Symbols
P2X1
NCBI Protein Information
P2X purinoceptor 1
UniProt Protein Name
P2X purinoceptor 1
Protein Family
UniProt Gene Name
P2RX1
UniProt Synonym Gene Names
P2X1; P2X1
UniProt Entry Name
P2RX1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]

Uniprot Description

P2X1: Ligand-gated ion channel with relatively high calcium permeability. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Seems to be linked to apoptosis, by increasing the intracellular concentration of calcium in the presence of ATP, leading to programmed cell death. Belongs to the P2X receptor family.

Protein type: Membrane protein, integral; Channel, ligand-gated; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 17p13.3

Cellular Component: integral to nuclear inner membrane; plasma membrane

Molecular Function: cation channel activity; purinergic nucleotide receptor activity

Biological Process: blood coagulation; ion transport; signal transduction; transport

Disease: Bleeding Disorder, Platelet-type, 8

Research Articles on P2RX1

Similar Products

Product Notes

The P2RX1 p2rx1 (Catalog #AAA1267790) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacggc ggttccagga ggagctggcc gccttcctct tcgagtatga caccccccgc atggtgctgg tgcgtaataa gaaggtgggc gttatcttcc gactgatcca gctggtggtc ctggtctacg tcatcgggtg ggtgtttctc tatgagaagg gctaccagac ctcgagcggc ctcatcagca gtgtctctgt gaaactcaag ggcctggccg tgacccagct ccctggcctc ggcccccagg tctgggatgt ggctgactac gtcttcccag cccaggggga caactccttc gtggtcatga ccaatttcat cgtgaccccg aagcagactc aaggctactg cgcagagcac ccagaagggg gcatatgcaa ggaagacagt ggctgtaccc ctgggaaggc caagaggaag gcccaaggca tccgcacggg caagtgtgtg gccttcaacg acactgtgaa gacgtgtgag atctttggct ggtgccccgt ggaggtggat gacgacatcc cgcgccctgc ccttctccga gaggccgaga acttcactct tttcatcaag aacagcatca gctttccacg cttcaaggtc aacaggcgca acctggtgga ggaggtgaat gctgcccaca tgaagacctg cctctttcac aagaccctgc accccctgtg cccagtcttc cagcttggct acgtggtgca agagtcaggc cagaacttca gcaccctggc tgagaagggt ggagtggttg gcatcaccat cgactggcac tgtgacctgg actggcacgt acggcactgc agacccatct atgagttcca tgggctgtac gaagagaaaa atctctcccc aggcttcaac ttcaggtttg ccaggcactt tgtggagaac gggaccaact accgtcacct cttcaaggtg tttgggattc gctttgacat cctggtggac ggcaaggccg ggaagtttga catcatccct acaatgacca ccatcggctc tggaattggc atctttgggg tggccacagt tctctgtgac ctgctgctgc ttcacatcct gcctaagagg cactactaca agcagaagaa gttcaaatac gctgaggaca tggggccagg ggcggctgag cgtgacctcg cagctaccag ctccaccctg ggcctgcagg agaacatgag gacatcctga. It is sometimes possible for the material contained within the vial of "P2RX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.