Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OTUB1 cdna clone

OTUB1 cDNA Clone

Gene Names
OTUB1; OTB1; OTU1; HSPC263
Synonyms
OTUB1; OTUB1 cDNA Clone; OTUB1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggaggaacctcagcagcagaagcaggagccgctgggcagcgactccgaaggtgttaactgtctggcctatgatgaagccatcatggctcagcaggaccgaattcagcaagagattgctgtgcagaaccctctggtgtcagagcggctggagctctcggtcctatacaaggagtatgctgaagatgacaacatctatcaacagaagatcaaggacctccacaaaaagtactcgtacatccgcaagaccaggcctgacggcaactgtttctatcgggctttcggattctcccacttggaggcactgctggatgacagcaaggagttgcagcggttcaaggctgtgtctgccaagagcaaggaagacctggtgtcccagggcttcactgaattcacaattgaggatttccacaacacgttcatggacctgattgagcaggtggagaagcagacctctgtcgccgacctgctggcctccttcaatgaccagagcacctccgactaccttgtggtctacctgcggctgctcacctcgggctacctgcagcgcgagagcaagttcttcgagcacttcatcgagggtggacggactgtcaaggagttctgccagcaggaggtggagcccatgtgcaaggagagcgaccacatccacatcattgcgctggcccaggccctcagcgtgtccatccaggtggagtacatggaccgcggcgagggcggcaccaccaatccgcacatcttccctgagggctccgagcccaaggtctaccttctctaccggcctggacactacgatatcctctacaaatag
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,285 Da
NCBI Official Full Name
Homo sapiens OTU domain, ubiquitin aldehyde binding 1, mRNA
NCBI Official Synonym Full Names
OTU deubiquitinase, ubiquitin aldehyde binding 1
NCBI Official Symbol
OTUB1
NCBI Official Synonym Symbols
OTB1; OTU1; HSPC263
NCBI Protein Information
ubiquitin thioesterase OTUB1
UniProt Protein Name
Ubiquitin thioesterase OTUB1
Protein Family
UniProt Gene Name
OTUB1
UniProt Synonym Gene Names
OTB1; OTU1; hOTU1
UniProt Entry Name
OTUB1_HUMAN

NCBI Description

The product of this gene is a member of the OTU (ovarian tumor) superfamily of predicted cysteine proteases. The encoded protein is a highly specific ubiquitin iso-peptidase, and cleaves ubiquitin from branched poly-ubiquitin chains but not from ubiquitinated substrates. It interacts with another ubiquitin protease and an E3 ubiquitin ligase that inhibits cytokine gene transcription in the immune system. It is proposed to function in specific ubiquitin-dependent pathways, possibly by providing an editing function for polyubiquitin chain growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

OTUB1: a protease that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation. Regulator of T-cell anergy, a phenomenon that occur when T-cell are rendered unresponsive to antigen rechallenge and no longer respond to their cognate antigen. Acts via its interaction with RNF128/GRAIL, a crucial inductor of CD4 T-cell anergy. Two alternatively spliced isoforms are known.

Protein type: Ubiquitin conjugating system; Ubiquitin-specific protease; Protease; EC 3.4.19.12

Chromosomal Location of Human Ortholog: 11q13.1

Cellular Component: nucleus

Molecular Function: NEDD8-specific protease activity; protein binding; ubiquitin binding; ubiquitin protein ligase binding; ubiquitin-specific protease activity

Biological Process: response to DNA damage stimulus

Research Articles on OTUB1

Similar Products

Product Notes

The OTUB1 otub1 (Catalog #AAA1276960) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg aggaacctca gcagcagaag caggagccgc tgggcagcga ctccgaaggt gttaactgtc tggcctatga tgaagccatc atggctcagc aggaccgaat tcagcaagag attgctgtgc agaaccctct ggtgtcagag cggctggagc tctcggtcct atacaaggag tatgctgaag atgacaacat ctatcaacag aagatcaagg acctccacaa aaagtactcg tacatccgca agaccaggcc tgacggcaac tgtttctatc gggctttcgg attctcccac ttggaggcac tgctggatga cagcaaggag ttgcagcggt tcaaggctgt gtctgccaag agcaaggaag acctggtgtc ccagggcttc actgaattca caattgagga tttccacaac acgttcatgg acctgattga gcaggtggag aagcagacct ctgtcgccga cctgctggcc tccttcaatg accagagcac ctccgactac cttgtggtct acctgcggct gctcacctcg ggctacctgc agcgcgagag caagttcttc gagcacttca tcgagggtgg acggactgtc aaggagttct gccagcagga ggtggagccc atgtgcaagg agagcgacca catccacatc attgcgctgg cccaggccct cagcgtgtcc atccaggtgg agtacatgga ccgcggcgag ggcggcacca ccaatccgca catcttccct gagggctccg agcccaaggt ctaccttctc taccggcctg gacactacga tatcctctac aaatag. It is sometimes possible for the material contained within the vial of "OTUB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.