OS9 cdna clone
OS9 cDNA Clone
Gene Names
OS9; OS-9; ERLEC2
Synonyms
OS9; OS9 cDNA Clone; OS9 cdna clone
Sequence
atggcggcggaaacgctgctgtccagtttgttaggactgctgcttctgggactcctgttacccgcaagtctgaccggcggtgtcgggagcctgaacctggaggagctgagtgagatgcgttatgggatcgagatcctgccgttgcctgtcatgggagggcagagccaatcttcggacgtggtgattgtctcctctaagtacaaacagcgctatgagtgtcgcctgccagctggagctattcacttccagcgtgaaagggaggaggaaacacctgcttaccaagggcctgggatccctgagttgttgagcccaatgagagatgctccctgcttgctgaagacaaaggactggtggacatatgaattctgttatggacgccacatccagcaataccacatggaagattcagagatcaaaggtgaagtcctctatctcggctactaccaatcagccttcgactgggatgatgaaacagccaaggcctccaagcagcatcgtcttaaacgctaccacagccagacctatggcaatgggtccaagtgcgaccttaatgggaggccccgggaggccgaggttcggttcctctgtgacgagggtgcaggtatctctggggactacatcgatcgcgtggacgagcccttgtcctgctcttatgtgctgaccattcgcactcctcggctctgcccccaccctctcctccggcccccacccagtgctgcaccgcaggccatcctctgtcacccttccctacagcctgaggagtacatggcctacgttcagaggcaagccgactcaaagcagtatggagataaaatcatagaggagctgcaagatctaggcccccaagtgtggagtgagaccaagtctggggtggcaccccaaaagatggcaggtgcgagcccgaccaaggatgacagtaaggactcagatttctggaagatgcttaatgagccagaggaccaggccccaggaggggaggaggtgccggctgaggagcaggacccaagccctgaggcagcagattcagcttctggtgctcccaatgattttcagaacaacgtgcaggtcaaagtcattcgaagccctgcggatttgattcgattcatagaggagctgaaaggtggaacaaaaaaggggaagccaaatataggccaagagcagcctgtggatgatgctgcagaagtccctcagagggaaccagagaaggaaaggggtgatccagaacggcagagagagatggaagaagaggaggatgaggatgaggatgaggatgaagatgaggatgaacggcagttactgggagaatttgagaaggaactggaagggatcctgcttccgtcagaccgagaccggctccgttcggaggtgaaggctggcatggagcgggaactggaaaacatcatccaggagacagagaaagagctggacccagatgggctgaagaaggagtcagagcgggatcgggcaatgctggctctcacatccactctcaacaaactcatcaaaagactggaggaaaaacagagtccagagctggtgaagaagcacaagaaaaagagggttgtccccaaaaagcctcccccatcaccccaacctacagggaaaattgagatcaaaattgtccgcccatgggctgaagggactgaagagggtgcacgttggctgactgatgaggacacgagaaacctcaaggagatcttcttcaatatcttggtgccgggagctgaagaggcccagaaggaacgccagcggcagaaagagctggagagcaattaccgccgggtgtggggctctccaggtggggagggcacaggggacctggacgaatttgacttctga
Sequence Length
1839
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,847 Da
NCBI Official Full Name
Homo sapiens osteosarcoma amplified 9, endoplasmic reticulum associated protein, mRNA
NCBI Official Synonym Full Names
OS9, endoplasmic reticulum lectin
NCBI Official Symbol
OS9
NCBI Official Synonym Symbols
OS-9; ERLEC2
NCBI Protein Information
protein OS-9
UniProt Protein Name
Protein OS-9
Protein Family
UniProt Gene Name
OS9
UniProt Entry Name
OS9_HUMAN
NCBI Description
This gene encodes a protein that is highly expressed in osteosarcomas. This protein binds to the hypoxia-inducible factor 1 (HIF-1), a key regulator of the hypoxic response and angiogenesis, and promotes the degradation of one of its subunits. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Uniprot Description
OS9: Lectin which functions in endoplasmic reticulum (ER) quality control and ER-associated degradation (ERAD). May bind terminally misfolded non-glycosylated proteins as well as improperly folded glycoproteins, retain them in the ER, and possibly transfer them to the ubiquitination machinery and promote their degradation. Possible targets include TRPV4. Belongs to the OS-9 family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Endoplasmic reticulum
Chromosomal Location of Human Ortholog: 12q13
Cellular Component: endoplasmic reticulum lumen; endoplasmic reticulum membrane
Molecular Function: glycoprotein binding; protein binding
Biological Process: ER-associated protein catabolic process; protein retention in ER; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process
Research Articles on OS9
Similar Products
Product Notes
The OS9 os9 (Catalog #AAA1266056) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg aaacgctgct gtccagtttg ttaggactgc tgcttctggg actcctgtta cccgcaagtc tgaccggcgg tgtcgggagc ctgaacctgg aggagctgag tgagatgcgt tatgggatcg agatcctgcc gttgcctgtc atgggagggc agagccaatc ttcggacgtg gtgattgtct cctctaagta caaacagcgc tatgagtgtc gcctgccagc tggagctatt cacttccagc gtgaaaggga ggaggaaaca cctgcttacc aagggcctgg gatccctgag ttgttgagcc caatgagaga tgctccctgc ttgctgaaga caaaggactg gtggacatat gaattctgtt atggacgcca catccagcaa taccacatgg aagattcaga gatcaaaggt gaagtcctct atctcggcta ctaccaatca gccttcgact gggatgatga aacagccaag gcctccaagc agcatcgtct taaacgctac cacagccaga cctatggcaa tgggtccaag tgcgacctta atgggaggcc ccgggaggcc gaggttcggt tcctctgtga cgagggtgca ggtatctctg gggactacat cgatcgcgtg gacgagccct tgtcctgctc ttatgtgctg accattcgca ctcctcggct ctgcccccac cctctcctcc ggcccccacc cagtgctgca ccgcaggcca tcctctgtca cccttcccta cagcctgagg agtacatggc ctacgttcag aggcaagccg actcaaagca gtatggagat aaaatcatag aggagctgca agatctaggc ccccaagtgt ggagtgagac caagtctggg gtggcacccc aaaagatggc aggtgcgagc ccgaccaagg atgacagtaa ggactcagat ttctggaaga tgcttaatga gccagaggac caggccccag gaggggagga ggtgccggct gaggagcagg acccaagccc tgaggcagca gattcagctt ctggtgctcc caatgatttt cagaacaacg tgcaggtcaa agtcattcga agccctgcgg atttgattcg attcatagag gagctgaaag gtggaacaaa aaaggggaag ccaaatatag gccaagagca gcctgtggat gatgctgcag aagtccctca gagggaacca gagaaggaaa ggggtgatcc agaacggcag agagagatgg aagaagagga ggatgaggat gaggatgagg atgaagatga ggatgaacgg cagttactgg gagaatttga gaaggaactg gaagggatcc tgcttccgtc agaccgagac cggctccgtt cggaggtgaa ggctggcatg gagcgggaac tggaaaacat catccaggag acagagaaag agctggaccc agatgggctg aagaaggagt cagagcggga tcgggcaatg ctggctctca catccactct caacaaactc atcaaaagac tggaggaaaa acagagtcca gagctggtga agaagcacaa gaaaaagagg gttgtcccca aaaagcctcc cccatcaccc caacctacag ggaaaattga gatcaaaatt gtccgcccat gggctgaagg gactgaagag ggtgcacgtt ggctgactga tgaggacacg agaaacctca aggagatctt cttcaatatc ttggtgccgg gagctgaaga ggcccagaag gaacgccagc ggcagaaaga gctggagagc aattaccgcc gggtgtgggg ctctccaggt ggggagggca caggggacct ggacgaattt gacttctga. It is sometimes possible for the material contained within the vial of "OS9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
