Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ORAI1 cdna clone

ORAI1 cDNA Clone

Gene Names
ORAI1; IMD9; TAM2; ORAT1; CRACM1; TMEM142A
Synonyms
ORAI1; ORAI1 cDNA Clone; ORAI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcctcaacgagcactccatgcaggcgctgtcctggcgcaagctctacttgagccgcgccaagcttaaagcctccagccggacctcggctctgctctccggcttcgccatggtggcaatggtggaggtgcagctggacgctgaccacgactacccaccggggctgctcatcgccttcagtgcctgcaccacagtgctggtggctgtgcacctgtttgcgctcatgatcagcacctgcatcctgcccaacatcgaggcggtgagcaacgtgcacaatctcaactcggtcaaggagtccccccatgagcgcatgcaccgccacatcgagctggcctgggccttctccaccgtcatcggcacgctgctcttcctagctgaggtggtgctgctctgctgggtcaagttcttgcccctcaagaagcagccaggccagccaaggcccaccagcaagccccccgccggtggcgcagcagccaacgtcagcaccagcggcatcaccccgggccaggcagccgccatcgcctcgaccaccatcatggtgcccttcggcctgatctttatcgtcttcgccgtccacttctaccgctcactggtcagccataagaccgaccgacagttccaggagctcaacgagctggcggagtttgcccgcttacaggaccagctggaccacagaggggaccaccccctgacgcccggcagccactatgcctag
Sequence Length
717
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,337 Da
NCBI Official Full Name
Homo sapiens ORAI calcium release-activated calcium modulator 1, mRNA
NCBI Official Synonym Full Names
ORAI calcium release-activated calcium modulator 1
NCBI Official Symbol
ORAI1
NCBI Official Synonym Symbols
IMD9; TAM2; ORAT1; CRACM1; TMEM142A
NCBI Protein Information
calcium release-activated calcium channel protein 1
UniProt Protein Name
Calcium release-activated calcium channel protein 1
UniProt Gene Name
ORAI1
UniProt Synonym Gene Names
CRACM1; TMEM142A
UniProt Entry Name
CRCM1_HUMAN

NCBI Description

The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 1 (IDTICED1). [provided by RefSeq, Sep 2011]

Uniprot Description

ORAI1: Ca(2+) release-activated Ca(2+) (CRAC) channel subunit which mediates Ca(2+) influx following depletion of intracellular Ca(2+) stores and channel activation by the Ca(2+) sensor, STIM1. CRAC channels are the main pathway for Ca(2+) influx in T-cells and promote the immune response to pathogens by activating the transcription factor NFAT. Interacts with STIM1 and STIM2. Interacts with EFCAB4B/CRACR2A; the interaction is direct and takes place in absence of Ca(2+). Forms a complex with EFCAB4B/CRACR2A and STIM1 at low concentration of Ca(2+), the complex dissociates at elevated Ca(2+) concentrations. Belongs to the Orai family.

Protein type: Membrane protein, multi-pass; Channel, calcium; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: autophagic vacuole; integral to plasma membrane; membrane

Molecular Function: identical protein binding; protein binding; store-operated calcium channel activity

Biological Process: positive regulation of calcium ion transport; regulation of calcium ion transport

Disease: Immunodeficiency 9; Myopathy, Tubular Aggregate, 2

Research Articles on ORAI1

Similar Products

Product Notes

The ORAI1 orai1 (Catalog #AAA1275391) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcctca acgagcactc catgcaggcg ctgtcctggc gcaagctcta cttgagccgc gccaagctta aagcctccag ccggacctcg gctctgctct ccggcttcgc catggtggca atggtggagg tgcagctgga cgctgaccac gactacccac cggggctgct catcgccttc agtgcctgca ccacagtgct ggtggctgtg cacctgtttg cgctcatgat cagcacctgc atcctgccca acatcgaggc ggtgagcaac gtgcacaatc tcaactcggt caaggagtcc ccccatgagc gcatgcaccg ccacatcgag ctggcctggg ccttctccac cgtcatcggc acgctgctct tcctagctga ggtggtgctg ctctgctggg tcaagttctt gcccctcaag aagcagccag gccagccaag gcccaccagc aagccccccg ccggtggcgc agcagccaac gtcagcacca gcggcatcac cccgggccag gcagccgcca tcgcctcgac caccatcatg gtgcccttcg gcctgatctt tatcgtcttc gccgtccact tctaccgctc actggtcagc cataagaccg accgacagtt ccaggagctc aacgagctgg cggagtttgc ccgcttacag gaccagctgg accacagagg ggaccacccc ctgacgcccg gcagccacta tgcctag. It is sometimes possible for the material contained within the vial of "ORAI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.