Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OPN3 cdna clone

OPN3 cDNA Clone

Gene Names
OPN3; ECPN; PPP1R116
Synonyms
OPN3; OPN3 cDNA Clone; OPN3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtactcggggaaccgcagcggcggccacggctactgggacggcggcggggccgcgggcgctgaggggccggcgccggcggggacactgagccccgcgcccctcttcagccccggcacctacgagcgcctggcgctgctgctgggctccattgggctgctgggcgtcggcaacaacctgctggtgctcgtcctctactacaagttccagcggctccgcactcccactcacctcctcctggtcaacatcagcctcagcgacctgctggtgtccctcttcggggtcacctttaccttcgtgtcctgcctgaggaacggctgggtgtgggacaccgtgggctgcgtgtgggacgggtttagcggcagcctcttcgggattgtttccattgccaccctaaccgtgctggcctatgaacgttacattcgcgtggtccatgccagagtgatcaatttttcctgggcctggagggccattacctacatctggctctactcactggcgtgggcaggagcacctctcctgggatggaacaggtacatcctggacgtacacggactaggctgcactgtggactggaaatccaaggatgccaacgattcctcctttgtgcttttcttatttcttggctgcctggtggtgcccctgggtgtcatagcccattgctatggccatattctatattccattcgaatgcttcgttgtgtggaagatcttcagacaattcaagtgatcaagattttaaaatatgaaaagaaactggccaaaatgtgctttttaatgatattcaccttcctggtctgttggatgccttatatcgtgatctgcttcttggtggttaatggtcatggtcacctggtcactccaacaatatctattgtttcgtacctctttgctaaatcgaacactgtatacaatccagtgatttatgtcttcatgatcagaaagtttcgaagatcccttttgcagcttctgtgcctccgactgctgaggtgccagaggcctgctaaagacctaccagcagctggaagtgaaatgcagatcagacccattgtgatgtcacagaaagatggggacaggccaaagaaaaaagtgactttcaactcttcttccatcatttttatcatcaccagtgatgaatcactgtcagttgacgacagcgacaaaaccaatgggtccaaagttgatgtaatccaagttcgtcctttgtag
Sequence Length
1209
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,730 Da
NCBI Official Full Name
Homo sapiens opsin 3, mRNA
NCBI Official Synonym Full Names
opsin 3
NCBI Official Symbol
OPN3
NCBI Official Synonym Symbols
ECPN; PPP1R116
NCBI Protein Information
opsin-3
UniProt Protein Name
Opsin-3
Protein Family
UniProt Gene Name
OPN3
UniProt Synonym Gene Names
ECPN
UniProt Entry Name
OPN3_HUMAN

NCBI Description

Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. In addition to the visual opsins, mammals possess several photoreceptive non-visual opsins that are expressed in extraocular tissues. This gene, opsin 3, is strongly expressed in brain and testis and weakly expressed in liver, placenta, heart, lung, skeletal muscle, kidney, and pancreas. The gene may also be expressed in the retina. The protein has the canonical features of a photoreceptive opsin protein. [provided by RefSeq, Jul 2008]

Uniprot Description

encephalopsin: May play a role in encephalic photoreception. Belongs to the G-protein coupled receptor 1 family. Opsin subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR; GPCR, family 1

Chromosomal Location of Human Ortholog: 1q43

Cellular Component: integral to plasma membrane

Molecular Function: G-protein coupled photoreceptor activity; G-protein coupled receptor activity

Biological Process: phototransduction

Research Articles on OPN3

Similar Products

Product Notes

The OPN3 opn3 (Catalog #AAA1269937) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtactcgg ggaaccgcag cggcggccac ggctactggg acggcggcgg ggccgcgggc gctgaggggc cggcgccggc ggggacactg agccccgcgc ccctcttcag ccccggcacc tacgagcgcc tggcgctgct gctgggctcc attgggctgc tgggcgtcgg caacaacctg ctggtgctcg tcctctacta caagttccag cggctccgca ctcccactca cctcctcctg gtcaacatca gcctcagcga cctgctggtg tccctcttcg gggtcacctt taccttcgtg tcctgcctga ggaacggctg ggtgtgggac accgtgggct gcgtgtggga cgggtttagc ggcagcctct tcgggattgt ttccattgcc accctaaccg tgctggccta tgaacgttac attcgcgtgg tccatgccag agtgatcaat ttttcctggg cctggagggc cattacctac atctggctct actcactggc gtgggcagga gcacctctcc tgggatggaa caggtacatc ctggacgtac acggactagg ctgcactgtg gactggaaat ccaaggatgc caacgattcc tcctttgtgc ttttcttatt tcttggctgc ctggtggtgc ccctgggtgt catagcccat tgctatggcc atattctata ttccattcga atgcttcgtt gtgtggaaga tcttcagaca attcaagtga tcaagatttt aaaatatgaa aagaaactgg ccaaaatgtg ctttttaatg atattcacct tcctggtctg ttggatgcct tatatcgtga tctgcttctt ggtggttaat ggtcatggtc acctggtcac tccaacaata tctattgttt cgtacctctt tgctaaatcg aacactgtat acaatccagt gatttatgtc ttcatgatca gaaagtttcg aagatccctt ttgcagcttc tgtgcctccg actgctgagg tgccagaggc ctgctaaaga cctaccagca gctggaagtg aaatgcagat cagacccatt gtgatgtcac agaaagatgg ggacaggcca aagaaaaaag tgactttcaa ctcttcttcc atcattttta tcatcaccag tgatgaatca ctgtcagttg acgacagcga caaaaccaat gggtccaaag ttgatgtaat ccaagttcgt cctttgtag. It is sometimes possible for the material contained within the vial of "OPN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.