Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OIT3 cdna clone

OIT3 cDNA Clone

Gene Names
OIT3; LZP
Synonyms
OIT3; OIT3 cDNA Clone; OIT3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctccattcctgcttctcacctgcctcttcatcacaggcacctccgtgtcacccgtggccctagatccttgttctgcttacatcagcctgaatgagccctggaggaacactgaccaccagttggatgagtctcaaggtcctcctctatgtgacaaccatgtgaatggggagtggtaccacttcacgggcatggcgggagatgccatgcctaccttctgcataccagaaaaccactgtggaacccacgcacctgtctggctcaatggcagccaccccctagaaggcgacggcattgtgcaacgccaggcttgtgccagcttcaatgggaactgctgtctctggaacaccacggtggaagtcaaggcttgccctggaggctactatgtgtatcgtctgaccaagcccagcgtctgcttccacgtctactgtggtcatttttatgacatctgcgacgaggactgccatggcagctgctcagataccagcgagtgcacatgcgctccaggaactgtgctaggccctgacaggcagacatgctttgatgaaaatgaatgtgagcaaaacaacggtggctgcagtgagatctgtgtgaacctcaaaaactcctaccgctgtgagtgtggggttggccgtgtgctaagaagtgatggcaagacttgtgaagacgttgaaggatgccacaataacaatggtggctgcagccactcttgccttggatctgagaaaggctaccagtgtgaatgtccccggggcctggtgctgtctgaggataaccacacttgccaagtccctgtgttgtgcaaatcaaatgccattgaagtgaacatccccagggagctggttggtggcctggagctcttcctgaccaacacctcctgccgaggagtgtccaacggcacccatgtcaacatcctcttctctctcaagacatgtggtacagtggtcgatctgtgtttcagatga
Sequence Length
966
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,911 Da
NCBI Official Full Name
Homo sapiens oncoprotein induced transcript 3, mRNA
NCBI Official Synonym Full Names
oncoprotein induced transcript 3
NCBI Official Symbol
OIT3
NCBI Official Synonym Symbols
LZP
NCBI Protein Information
oncoprotein-induced transcript 3 protein
UniProt Protein Name
Oncoprotein-induced transcript 3 protein
UniProt Gene Name
OIT3
UniProt Synonym Gene Names
LZP
UniProt Entry Name
OIT3_HUMAN

Uniprot Description

LZP: a liver-specific protein possibly involved in hepatocellular function and development. Contains 3 epidermal growth factor (EGF)-like domains and a ZP domain. Human LZP is expressed specifically in liver out of 23 tissues examined, and its mouse counterpart was detected at very early stage during embryo development.

Protein type: Calcium-binding; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 10q22.1

Molecular Function: protein binding

Research Articles on OIT3

Similar Products

Product Notes

The OIT3 oit3 (Catalog #AAA1273436) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctccat tcctgcttct cacctgcctc ttcatcacag gcacctccgt gtcacccgtg gccctagatc cttgttctgc ttacatcagc ctgaatgagc cctggaggaa cactgaccac cagttggatg agtctcaagg tcctcctcta tgtgacaacc atgtgaatgg ggagtggtac cacttcacgg gcatggcggg agatgccatg cctaccttct gcataccaga aaaccactgt ggaacccacg cacctgtctg gctcaatggc agccaccccc tagaaggcga cggcattgtg caacgccagg cttgtgccag cttcaatggg aactgctgtc tctggaacac cacggtggaa gtcaaggctt gccctggagg ctactatgtg tatcgtctga ccaagcccag cgtctgcttc cacgtctact gtggtcattt ttatgacatc tgcgacgagg actgccatgg cagctgctca gataccagcg agtgcacatg cgctccagga actgtgctag gccctgacag gcagacatgc tttgatgaaa atgaatgtga gcaaaacaac ggtggctgca gtgagatctg tgtgaacctc aaaaactcct accgctgtga gtgtggggtt ggccgtgtgc taagaagtga tggcaagact tgtgaagacg ttgaaggatg ccacaataac aatggtggct gcagccactc ttgccttgga tctgagaaag gctaccagtg tgaatgtccc cggggcctgg tgctgtctga ggataaccac acttgccaag tccctgtgtt gtgcaaatca aatgccattg aagtgaacat ccccagggag ctggttggtg gcctggagct cttcctgacc aacacctcct gccgaggagt gtccaacggc acccatgtca acatcctctt ctctctcaag acatgtggta cagtggtcga tctgtgtttc agatga. It is sometimes possible for the material contained within the vial of "OIT3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.