Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OGT cdna clone

OGT cDNA Clone

Gene Names
OGT; HRNT1; HINCUT-1; O-GLCNAC
Synonyms
OGT; OGT cDNA Clone; OGT cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtcttccgtgggcaacgtggccgacagcacagggttagctgagttggcacatcgagaatatcaggcaggagattttgaggcagctgagagacactgcatgcagctctggagacaagagccagacaatactggtgtgcttttattactttcatctatacacttccagtgtcgaaggctggacagatctgctcactttagcactctggcaattaaacagaacccccttctggcagaagcttattcgaatttggggaatgtgtacaaggaaagagggcagttgcaggaggcaattgagcattatcgacatgcattgcgtctcaaacctgatttcatcgatggttatattaacctggcagccgccttggtagcagcgggtgacatggaaggggcagtacaagcttacgtctctgctcttcagtacaatcctgatttgtactgtgttcgcagtgacctggggaacctgctcaaagccctgggtcgcttggaagaagccaaggcatgttatttgaaagcaattgagacgcaaccgaactttgcagtagcttggagtaatcttggctgtgttttcaatgcacaaggggaaatttggcttgcaattcatcactttgaaaaggctgtcacccttgacccaaactttctggatgcttatatcaatttaggaaatgtcttgaaagaggcacgcatttttgacagagctgtggcagcttatcttcgtgccctaagtttgagtccaaatcacgcagtggtgcacggcaacctggcttgtgtatactatgagcaaggcctgatagatctggcaatagacacctacaggcgggctatcgaactacaaccacatttccctgatgcttactgcaacctagccaatgctctcaaagagaagggcagtgttgctgaagcagaagattgttataatacagctctccgtctgtgtcccacccatgcagactctctgaataacctagccaatatcaaacgagaacagggaaacattgaagaggcagttcgcttgtatcgtaaagcattagaagtcttcccagagtttgctgctgcccattcaaatttagcaagtgtactgcagcagcagggaaaactgcaggaagctctgatgcattataaggaggctattcgaatcagtcctacctttgctgatgcctactctaatatgggaaacactctaaaggagatgcaggatgttcagggagccttgcagtgttatacgcgtgccatccaaattaatcctgcatttgcagatgcacatagcaatctggcttccattcataaggattcagggaatattccagaagccatagcttcttaccgcacggctctgaaacttaagcctgattttcctgatgcttattgtaacttggctcattgcctgcagattgtctgtgattggacagactatgatgagcgaatgaagaagttggtcagtattgtggctgaccagttagagaagaataggttgccttctgtgcatcctcatcatagtatgctatatcctctttctcatggcttcaggaaggctattgctgagaggcacggcaacctgtgcttagataagattaatgttcttcataaaccaccatatgaacatccaaaagacttgaagctcagtgatggtcggctgcgtgtaggatatgtgagttccgactttgggaatcatcctacttctcaccttatgcagtctattccaggcatgcacaatcctgataaatttgaggtgttctgttatgccctgagcccagacgatggcacaaacttccgagtgaaggtgatggcagaagccaatcatttcattgatctttctcagattccatgcaatggaaaagcagctgatcgcatccatcaggatggaattcatatccttgtaaatatgaatggctatactaagggcgctcgaaatgagctttttgctctcaggccagctcctattcaggcaatgtggctgggataccctgggacgagtggtgcgcttttcatggattatattatcactgatcaggaaacttcgccagctgaagttgctgagcagtattccgagaaattggcttatatgccccacactttttttattggtgatcatgctaatatgttccctcacctgaagaaaaaagcagtcatcgattttaagtccaatgggcacatttatgacaatcggatagttctgaatggcatcgacctcaaagcatttcttgatagtctaccagatgtgaaaattgtcaagatgaagtgtcctgatggaggagacaatgcagatagcagtaacacagctcttaatatgcctgttattcctatgaatactattgcagaagcagttattgaaatgattaaccgaggacagattcaaataacaattaatggattcagtattagcaatggactggcaactactcagatcaacaataaggctgcaactggagaggaggttccccgtaccattattgtaaccacccgttctcagtacgggttaccagaagatgccatcgtatactgtaactttaatcagttgtataaaattgacccttctactttgcagatgtgggcaaacattctgaagcgtgttcccaatagtgtactctggctgttgcgttttccagcagtaggagaacctaatattcaacagtatgcacaaaacatgggcctgccccagaaccgtatcattttttcacctgttgctcctaaagaggaacacgtcaggagaggccagctggctgatgtctgcttggacactccactctgtaatgggcacaccacagggatggatgtcctctgggcagggacccccatggtgactatgccaggagagactcttgcttctcgagttgcagcatcccagctcacttgcttaggttgtcttgagcttattgctaaaaacagacaagaatatgaagacatagctgtgaagctgggaactgatctagaatacctgaagaaagttcgtggcaaagtctggaagcaaagaatatctagccctctgttcaacaccaaacaatacacaatggaactagagcggctctatctacagatgtgggagcattatgcagctggcaacaaacctgaccacatgattaagcctgttgaagtcactgagtcagcataa
Sequence Length
3111
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,536 Da
NCBI Official Full Name
Homo sapiens O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase), mRNA
NCBI Official Synonym Full Names
O-linked N-acetylglucosamine (GlcNAc) transferase
NCBI Official Symbol
OGT
NCBI Official Synonym Symbols
HRNT1; HINCUT-1; O-GLCNAC
NCBI Protein Information
UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase 110 kDa subunit
UniProt Protein Name
UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase 110 kDa subunit
UniProt Gene Name
OGT
UniProt Synonym Gene Names
OGT
UniProt Entry Name
OGT1_HUMAN

NCBI Description

This gene encodes a glycosyltransferase that catalyzes the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. Since both phosphorylation and glycosylation compete for similar serine or threonine residues, the two processes may compete for sites, or they may alter the substrate specificity of nearby sites by steric or electrostatic effects. The protein contains multiple tetratricopeptide repeats that are required for optimal recognition of substrates. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2009]

Uniprot Description

OGT: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in cytoplasmic and nuclear proteins resulting in their modification with a beta- linked N-acetylglucosamine (O-GlcNAc). Glycosylates a large and diverse number of proteins including histone H2B, AKT1, MLL5, MAPT/TAU and HCFC1. Can regulate their cellular processes via cross-talk between glycosylation and phosphorylation or by affecting proteolytic processing. Involved in insulin resistance in muscle and adipocyte cells via glycosylating insulin signaling components and inhibiting the 'Thr-308' phosphorylation of AKT1, enhancing IRS1 phosphorylation and attenuating insulin signaling. Component of a THAP1/THAP3-HCFC1-OGT complex that is required for the regulation of the transcriptional activity of RRM1. As part of the NSL complex it may be involved in acetylation of nucleosomal histone H4 on several lysine residues. Heterotrimer; consists of one 78 kDa subunit and two 110 kDa subunits dimerized via TPR repeats 6 and 7. Interacts (via TPR repeats 6 and 7) with ATXN10. Component of the MLL5-L complex, at least composed of MLL5, STK38, PPP1CA, PPP1CB, HCFC1, PPP1CC and ACTB. Component of a THAP1/THAP3-HCFC1-OGT complex. Component of the NSL complex at least composed of MOF/KAT8, KANSL1, KANSL2, KANSL3, MCRS1, PHF20, OGT1/OGT, WDR5 and HCFC1. Interacts directly with HCFC1; the interaction O- glycosylates HCFC1, regulates its proteolytic processing and transcriptional activity and, in turn, stabilizes OGT in the nucleus. Interacts (via TPRs 1-6) with SIN3A; the interaction mediates transcriptional repression in parallel with histone deacetylase. Induction of the nucleocytoplasmic OGT (ncOGT) isoform in the liver on glucose deprivation is mediated by the decreased hexosamine biosynthesis pathway (HBP) flux. Highly expressed in pancreas and to a lesser extent in skeletal muscle, heart, brain and placenta. Present in trace amounts in lung and liver. Subject to product inhibition by UDP. Belongs to the O-GlcNAc transferase family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.4.1.255; Glycan Metabolism - O-glycan biosynthesis; Transferase

Chromosomal Location of Human Ortholog: Xq13

Cellular Component: cytosol; histone acetyltransferase complex; nucleoplasm; nucleus; plasma membrane

Molecular Function: acetylglucosaminyltransferase activity; enzyme activator activity; histone acetyltransferase activity (H4-K16 specific); phosphatidylinositol-3,4,5-triphosphate binding; protein binding; protein N-acetylglucosaminyltransferase activity

Biological Process: apoptosis; circadian regulation of gene expression; negative regulation of protein ubiquitination; phosphoinositide-mediated signaling; positive regulation of granulocyte differentiation; positive regulation of histone H3-K4 methylation; positive regulation of proteolysis; positive regulation of transcription from RNA polymerase II promoter; protein amino acid O-linked glycosylation; regulation of glycolysis; regulation of insulin receptor signaling pathway; regulation of Rac protein signal transduction; response to insulin stimulus; response to nutrient; signal transduction

Research Articles on OGT

Similar Products

Product Notes

The OGT ogt (Catalog #AAA1278052) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtctt ccgtgggcaa cgtggccgac agcacagggt tagctgagtt ggcacatcga gaatatcagg caggagattt tgaggcagct gagagacact gcatgcagct ctggagacaa gagccagaca atactggtgt gcttttatta ctttcatcta tacacttcca gtgtcgaagg ctggacagat ctgctcactt tagcactctg gcaattaaac agaaccccct tctggcagaa gcttattcga atttggggaa tgtgtacaag gaaagagggc agttgcagga ggcaattgag cattatcgac atgcattgcg tctcaaacct gatttcatcg atggttatat taacctggca gccgccttgg tagcagcggg tgacatggaa ggggcagtac aagcttacgt ctctgctctt cagtacaatc ctgatttgta ctgtgttcgc agtgacctgg ggaacctgct caaagccctg ggtcgcttgg aagaagccaa ggcatgttat ttgaaagcaa ttgagacgca accgaacttt gcagtagctt ggagtaatct tggctgtgtt ttcaatgcac aaggggaaat ttggcttgca attcatcact ttgaaaaggc tgtcaccctt gacccaaact ttctggatgc ttatatcaat ttaggaaatg tcttgaaaga ggcacgcatt tttgacagag ctgtggcagc ttatcttcgt gccctaagtt tgagtccaaa tcacgcagtg gtgcacggca acctggcttg tgtatactat gagcaaggcc tgatagatct ggcaatagac acctacaggc gggctatcga actacaacca catttccctg atgcttactg caacctagcc aatgctctca aagagaaggg cagtgttgct gaagcagaag attgttataa tacagctctc cgtctgtgtc ccacccatgc agactctctg aataacctag ccaatatcaa acgagaacag ggaaacattg aagaggcagt tcgcttgtat cgtaaagcat tagaagtctt cccagagttt gctgctgccc attcaaattt agcaagtgta ctgcagcagc agggaaaact gcaggaagct ctgatgcatt ataaggaggc tattcgaatc agtcctacct ttgctgatgc ctactctaat atgggaaaca ctctaaagga gatgcaggat gttcagggag ccttgcagtg ttatacgcgt gccatccaaa ttaatcctgc atttgcagat gcacatagca atctggcttc cattcataag gattcaggga atattccaga agccatagct tcttaccgca cggctctgaa acttaagcct gattttcctg atgcttattg taacttggct cattgcctgc agattgtctg tgattggaca gactatgatg agcgaatgaa gaagttggtc agtattgtgg ctgaccagtt agagaagaat aggttgcctt ctgtgcatcc tcatcatagt atgctatatc ctctttctca tggcttcagg aaggctattg ctgagaggca cggcaacctg tgcttagata agattaatgt tcttcataaa ccaccatatg aacatccaaa agacttgaag ctcagtgatg gtcggctgcg tgtaggatat gtgagttccg actttgggaa tcatcctact tctcacctta tgcagtctat tccaggcatg cacaatcctg ataaatttga ggtgttctgt tatgccctga gcccagacga tggcacaaac ttccgagtga aggtgatggc agaagccaat catttcattg atctttctca gattccatgc aatggaaaag cagctgatcg catccatcag gatggaattc atatccttgt aaatatgaat ggctatacta agggcgctcg aaatgagctt tttgctctca ggccagctcc tattcaggca atgtggctgg gataccctgg gacgagtggt gcgcttttca tggattatat tatcactgat caggaaactt cgccagctga agttgctgag cagtattccg agaaattggc ttatatgccc cacacttttt ttattggtga tcatgctaat atgttccctc acctgaagaa aaaagcagtc atcgatttta agtccaatgg gcacatttat gacaatcgga tagttctgaa tggcatcgac ctcaaagcat ttcttgatag tctaccagat gtgaaaattg tcaagatgaa gtgtcctgat ggaggagaca atgcagatag cagtaacaca gctcttaata tgcctgttat tcctatgaat actattgcag aagcagttat tgaaatgatt aaccgaggac agattcaaat aacaattaat ggattcagta ttagcaatgg actggcaact actcagatca acaataaggc tgcaactgga gaggaggttc cccgtaccat tattgtaacc acccgttctc agtacgggtt accagaagat gccatcgtat actgtaactt taatcagttg tataaaattg acccttctac tttgcagatg tgggcaaaca ttctgaagcg tgttcccaat agtgtactct ggctgttgcg ttttccagca gtaggagaac ctaatattca acagtatgca caaaacatgg gcctgcccca gaaccgtatc attttttcac ctgttgctcc taaagaggaa cacgtcagga gaggccagct ggctgatgtc tgcttggaca ctccactctg taatgggcac accacaggga tggatgtcct ctgggcaggg acccccatgg tgactatgcc aggagagact cttgcttctc gagttgcagc atcccagctc acttgcttag gttgtcttga gcttattgct aaaaacagac aagaatatga agacatagct gtgaagctgg gaactgatct agaatacctg aagaaagttc gtggcaaagt ctggaagcaa agaatatcta gccctctgtt caacaccaaa caatacacaa tggaactaga gcggctctat ctacagatgt gggagcatta tgcagctggc aacaaacctg accacatgat taagcctgtt gaagtcactg agtcagcata a. It is sometimes possible for the material contained within the vial of "OGT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.