OGFR cdna clone
OGFR cDNA Clone
Synonyms
OGFR; OGFR cDNA Clone; OGFR cdna clone
Sequence
atggacgaccccgactgcgactccacctgggaggaggacgaggaggatgcggaggacgcggaggacgaggactgcgaggacggcgaggccgccggcgcgagggacgcggacgcaggggacgaggacgaggagtcggaggagccgcgggcggcgcggcccagctcgttccagtccagaatgacagggtccagaaactggcgagccacgagggacatgtgtaggtatcggcacaactatccggatctggtggaacgagactgcaatggggacacgccaaacctgagtttctacagaaatgagatccgcttcctgcccaacggctgtttcattgaggacattcttcagaactggacggacaactatgacctccttgaggacaatcactcctacatccagtggctgtttcctctgcgagaaccaggagtgaactggcatgccaagcccctcacgctcagggaggtcgaggtgtttaaaagctcccaggagatccaggagcggcttgtccgggcctacgagctcatgctgggcttctacgggatccggctggaggaccgaggcacgggcacggtgggccgagcacagaactaccagaagcgcttccagaacctgaactggcgcagccacaacaacctccgcatcacacgcatcctcaagtcgctgggtgagctgggcctcgagcacttccaggcgccgctggtccgcttcttcctggaggagacgctggtgcggcgggagctgccgggggtgcggcagagtgccctggactacttcatgttcgccgtgcgctgccgacaccagcgccgccagctggtgcacttcgcctgggagcacttccggccccgctgcaagttcgtctgggggccccaagacaagctgcggaggttcaagcccagctctctgccccatccgctcgagggctccaggaaggtggaggaggaaggaagccccggggaccccgaccacgaggccagcacccagggtcggacctgtgggccagagcatagcaagggtgggggcagggtggacgaggggccccagccacggagcgtggagccccaggatgcgggacccctggagaggagccagggggatgaggcagggggccacggggaagataggccggagcccttaagccccaaagagagcaagaagaggaagctggagctgagccggcgggagcagccgcccacagagccaggccctcagagtgcctcagaggtggagaagatcgctctgaatttggaggggtgtgccctcagccagggcagcctcaggacggggacccaggaagtgggcggtcaggaccctggggaggcagtgcagccctgccgccaacccctgggagccagggtggccgacaaggtgaggaagcggaggaaggtggatgagggtgctggggacagtgctgcggtggccagtggtggtgcccagaccttggcccttgccgggtcccctgccccatcggggcaccccaaggctggacacagtgagaacggggttgaggaggacacagaaggtcgaacggggcccaaagaaggtacccctgggagcccatcggagaccccaggccccagcccagcaggacctgcaggggacgagccagccgagagcccatcggagaccccaggcccccgcccagcaggacctgcaggggacgagccagccgagagcccatcggagaccccaggccccagcccggcaggacctacaagggatgagccagccgagagcccatcggagaccccaggcccccgcccagcaggacctgcaggggacgagccagccgagagcccatcggagaccccaggcccccgcccggcaggacctgcaggggacgagccagccgagagcccatcggagaccccaggccccagcccggcaggacctacaagggatgagccagccaaggcgggggaggcagcagagttgcaggacgcagaggtggagtcttctgccaagtctgggaagccttaa
Sequence Length
1974
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
71,424 Da
NCBI Official Full Name
Homo sapiens opioid growth factor receptor, mRNA
NCBI Official Synonym Full Names
opioid growth factor receptor
NCBI Official Symbol
OGFR
NCBI Protein Information
opioid growth factor receptor
UniProt Protein Name
Opioid growth factor receptor
Protein Family
UniProt Gene Name
OGFR
UniProt Synonym Gene Names
OGFr
UniProt Entry Name
OGFR_HUMAN
NCBI Description
The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]-enkephalin. OGF is a negative regulator of cell proliferation and tissue organization in a variety of processes. The encoded unbound receptor for OGF has been localized to the outer nuclear envelope, where it binds OGF and is translocated into the nucleus. The coding sequence of this gene contains a polymorphic region of 60 nt tandem imperfect repeat units. Several transcripts containing between zero and eight repeat units have been reported. [provided by RefSeq, Jul 2008]
Uniprot Description
OGFR: Receptor for opioid growth factor (OGF), also known as Met-enkephalin. Seems to be involved in growth regulation. Belongs to the opioid growth factor receptor family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Receptor, misc.
Chromosomal Location of Human Ortholog: 20q13.3
Molecular Function: protein binding
Research Articles on OGFR
1. The blockade of OGF signaling by MNTX releases cells from their arrest and boosts the effect of Doc
Similar Products
Product Notes
The OGFR ogfr (Catalog #AAA1268229) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgacc ccgactgcga ctccacctgg gaggaggacg aggaggatgc ggaggacgcg gaggacgagg actgcgagga cggcgaggcc gccggcgcga gggacgcgga cgcaggggac gaggacgagg agtcggagga gccgcgggcg gcgcggccca gctcgttcca gtccagaatg acagggtcca gaaactggcg agccacgagg gacatgtgta ggtatcggca caactatccg gatctggtgg aacgagactg caatggggac acgccaaacc tgagtttcta cagaaatgag atccgcttcc tgcccaacgg ctgtttcatt gaggacattc ttcagaactg gacggacaac tatgacctcc ttgaggacaa tcactcctac atccagtggc tgtttcctct gcgagaacca ggagtgaact ggcatgccaa gcccctcacg ctcagggagg tcgaggtgtt taaaagctcc caggagatcc aggagcggct tgtccgggcc tacgagctca tgctgggctt ctacgggatc cggctggagg accgaggcac gggcacggtg ggccgagcac agaactacca gaagcgcttc cagaacctga actggcgcag ccacaacaac ctccgcatca cacgcatcct caagtcgctg ggtgagctgg gcctcgagca cttccaggcg ccgctggtcc gcttcttcct ggaggagacg ctggtgcggc gggagctgcc gggggtgcgg cagagtgccc tggactactt catgttcgcc gtgcgctgcc gacaccagcg ccgccagctg gtgcacttcg cctgggagca cttccggccc cgctgcaagt tcgtctgggg gccccaagac aagctgcgga ggttcaagcc cagctctctg ccccatccgc tcgagggctc caggaaggtg gaggaggaag gaagccccgg ggaccccgac cacgaggcca gcacccaggg tcggacctgt gggccagagc atagcaaggg tgggggcagg gtggacgagg ggccccagcc acggagcgtg gagccccagg atgcgggacc cctggagagg agccaggggg atgaggcagg gggccacggg gaagataggc cggagccctt aagccccaaa gagagcaaga agaggaagct ggagctgagc cggcgggagc agccgcccac agagccaggc cctcagagtg cctcagaggt ggagaagatc gctctgaatt tggaggggtg tgccctcagc cagggcagcc tcaggacggg gacccaggaa gtgggcggtc aggaccctgg ggaggcagtg cagccctgcc gccaacccct gggagccagg gtggccgaca aggtgaggaa gcggaggaag gtggatgagg gtgctgggga cagtgctgcg gtggccagtg gtggtgccca gaccttggcc cttgccgggt cccctgcccc atcggggcac cccaaggctg gacacagtga gaacggggtt gaggaggaca cagaaggtcg aacggggccc aaagaaggta cccctgggag cccatcggag accccaggcc ccagcccagc aggacctgca ggggacgagc cagccgagag cccatcggag accccaggcc cccgcccagc aggacctgca ggggacgagc cagccgagag cccatcggag accccaggcc ccagcccggc aggacctaca agggatgagc cagccgagag cccatcggag accccaggcc cccgcccagc aggacctgca ggggacgagc cagccgagag cccatcggag accccaggcc cccgcccggc aggacctgca ggggacgagc cagccgagag cccatcggag accccaggcc ccagcccggc aggacctaca agggatgagc cagccaaggc gggggaggca gcagagttgc aggacgcaga ggtggagtct tctgccaagt ctgggaagcc ttaa. It is sometimes possible for the material contained within the vial of "OGFR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
