ODF2 cdna clone
ODF2 cDNA Clone
Gene Names
ODF2; CT134; ODF84; ODF2/1; ODF2/2
Synonyms
ODF2; ODF2 cDNA Clone; ODF2 cdna clone
Sequence
atgaaaggggacactgtgaatgtgcggcggagtgtccgggtgaaaaccaagaatccacctcattgcctggagatcacgccaccatcttcagaaaagctggtctcagtgatgcggttaagtgacctctctacagaagatgatgactcaggtcactgtaaaatgaaccgttatgataagaagattgatagtctaatgaatgcggttggttgtctgaagtctgaggtcaagatgcaaaaaggtgagcgccagatggccaaaaggttcctggaggaacggaaggaagagctggaggaggtggcccacgaactggctgagactgagcacgagaacacggtgttgaggcacaacatcgagcgcatgaaggaggagaaggacttcaccatacttcagaagaaacacctacaacaggagaaggagtgcctcatgtccaagctggtggaggcggaaatggatggggctgcggctgccaagcaggtcatggccttgaaggataccatcgggaagctgaaaacggagaaacaaatgacctgcacggacatcaacaccctgacaaggcagaaggaacttctcctgcagaagctgagcacatttgaggagaccaaccgcaccctccgagacctcctgagggaacagcactgcaaagaggattctgaaagactaatggagcaacaaggagcactgctgaaacggctggcggaggccgactcagagaaagcgcgcctgctgttactgctgcaagacaaggacaaggaggtggaagagctccttcaggaaatacaatgtgagaaggctcaagcaaagacagcctctgagctttctaaatccatggagtccatgcgtgggcatttgcaggcacagcttcggtccaaagaggctgagaacagtcgcctgtgcatgcagattaagaatctggagcgcagcgggaatcagcataaggcagaagtggaggccatcatggagcagctgaaggagttgaagcagaagggagaccgagacaaagagagcttgaagaaggccatccgagcccagaaggagcgagccgagaagagcgaggagtatgctgagcagctacacgtgcaactcgctgacaaggatctttatgtcgctgaagctttatccactctggaatcctggaggagccgctacaaccaagttgtaaaagaaaagggagaccttgagctggaaattattgtcctgaatgaccgggtaacagatcttgtaaaccaacaacaaaccctggaggagaagatgcgggaagaccgggatagcctggtggagagactacaccgtcagactgctgagtattccgcattcaagctggagaatgagaggctgaaggccagctttgctccaatggaggacaaactcaaccaggcacacctcgaggtccagcagctgaaggcctcagtgaagaactatgaggggatgattgacaactataagagtcaggtgatgaagaccagattggaggctgatgaagtagctgcccagctagaacgctgtgacaaagagaacaagatccttaaagatgagatgaacaaagagattgaggcggcacgaaggcagttccagtctcagctggctgacctgcagcagctccctgacatcctgaagatcacggaggcgaagctggctgagtgccaagaccaactgcagggctatgagcggaagaacatcgacctcacagccatcatatcagacctgcgcagccggatcgaacaccagggggacaagctggagatggcgagagagaaacatcaggcttcccagaaggaaaataaacagctgagtctgaaggtggatgaactggagaggaaactggaggcgaccagtgcccagaatatcgagttcctacaggtgattgccaagagggaggaggcaatccaccagtcccagctgcggctggaggagaaaacacgggaatgtgggaccctggcaaggcagttggagagtgccattgaagatgcgaggaggcaggtggaacaaaccaaggagcacgcactctccaaggagcgagcagcccagaacaaaatcctggaccttgagacccagctgagcagaaccaaaacggaattgagccagctgcggcggagccgtgatgatgcggaccgccgctaccagagccggctgcaagacctgaaagatcgcctggagcagtccgagagcaccaaccgcagcatgcagaactacgtccagttcctcaaatcatcatacgccaacgtgtttggggatggtccctattccaccttcctgactagctctcccatccgctcccgatctcctcctgcctga
Sequence Length
2292
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
75,691 Da
NCBI Official Full Name
Homo sapiens outer dense fiber of sperm tails 2, mRNA
NCBI Official Synonym Full Names
outer dense fiber of sperm tails 2
NCBI Official Symbol
ODF2
NCBI Official Synonym Symbols
CT134; ODF84; ODF2/1; ODF2/2
NCBI Protein Information
outer dense fiber protein 2
UniProt Protein Name
Outer dense fiber protein 2
Protein Family
UniProt Gene Name
ODF2
UniProt Entry Name
ODFP2_HUMAN
NCBI Description
The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
Uniprot Description
ODF2: a protein of unknown function.
Protein type: Cytoskeletal; Cancer Testis Antigen (CTA)
Chromosomal Location of Human Ortholog: 9q34.11
Cellular Component: centriole; centrosome; cytosol; nucleus
Molecular Function: protein binding; structural molecule activity
Biological Process: G2/M transition of mitotic cell cycle
Research Articles on ODF2
Similar Products
Product Notes
The ODF2 odf2 (Catalog #AAA1272150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagggg acactgtgaa tgtgcggcgg agtgtccggg tgaaaaccaa gaatccacct cattgcctgg agatcacgcc accatcttca gaaaagctgg tctcagtgat gcggttaagt gacctctcta cagaagatga tgactcaggt cactgtaaaa tgaaccgtta tgataagaag attgatagtc taatgaatgc ggttggttgt ctgaagtctg aggtcaagat gcaaaaaggt gagcgccaga tggccaaaag gttcctggag gaacggaagg aagagctgga ggaggtggcc cacgaactgg ctgagactga gcacgagaac acggtgttga ggcacaacat cgagcgcatg aaggaggaga aggacttcac catacttcag aagaaacacc tacaacagga gaaggagtgc ctcatgtcca agctggtgga ggcggaaatg gatggggctg cggctgccaa gcaggtcatg gccttgaagg ataccatcgg gaagctgaaa acggagaaac aaatgacctg cacggacatc aacaccctga caaggcagaa ggaacttctc ctgcagaagc tgagcacatt tgaggagacc aaccgcaccc tccgagacct cctgagggaa cagcactgca aagaggattc tgaaagacta atggagcaac aaggagcact gctgaaacgg ctggcggagg ccgactcaga gaaagcgcgc ctgctgttac tgctgcaaga caaggacaag gaggtggaag agctccttca ggaaatacaa tgtgagaagg ctcaagcaaa gacagcctct gagctttcta aatccatgga gtccatgcgt gggcatttgc aggcacagct tcggtccaaa gaggctgaga acagtcgcct gtgcatgcag attaagaatc tggagcgcag cgggaatcag cataaggcag aagtggaggc catcatggag cagctgaagg agttgaagca gaagggagac cgagacaaag agagcttgaa gaaggccatc cgagcccaga aggagcgagc cgagaagagc gaggagtatg ctgagcagct acacgtgcaa ctcgctgaca aggatcttta tgtcgctgaa gctttatcca ctctggaatc ctggaggagc cgctacaacc aagttgtaaa agaaaaggga gaccttgagc tggaaattat tgtcctgaat gaccgggtaa cagatcttgt aaaccaacaa caaaccctgg aggagaagat gcgggaagac cgggatagcc tggtggagag actacaccgt cagactgctg agtattccgc attcaagctg gagaatgaga ggctgaaggc cagctttgct ccaatggagg acaaactcaa ccaggcacac ctcgaggtcc agcagctgaa ggcctcagtg aagaactatg aggggatgat tgacaactat aagagtcagg tgatgaagac cagattggag gctgatgaag tagctgccca gctagaacgc tgtgacaaag agaacaagat ccttaaagat gagatgaaca aagagattga ggcggcacga aggcagttcc agtctcagct ggctgacctg cagcagctcc ctgacatcct gaagatcacg gaggcgaagc tggctgagtg ccaagaccaa ctgcagggct atgagcggaa gaacatcgac ctcacagcca tcatatcaga cctgcgcagc cggatcgaac accaggggga caagctggag atggcgagag agaaacatca ggcttcccag aaggaaaata aacagctgag tctgaaggtg gatgaactgg agaggaaact ggaggcgacc agtgcccaga atatcgagtt cctacaggtg attgccaaga gggaggaggc aatccaccag tcccagctgc ggctggagga gaaaacacgg gaatgtggga ccctggcaag gcagttggag agtgccattg aagatgcgag gaggcaggtg gaacaaacca aggagcacgc actctccaag gagcgagcag cccagaacaa aatcctggac cttgagaccc agctgagcag aaccaaaacg gaattgagcc agctgcggcg gagccgtgat gatgcggacc gccgctacca gagccggctg caagacctga aagatcgcct ggagcagtcc gagagcacca accgcagcat gcagaactac gtccagttcc tcaaatcatc atacgccaac gtgtttgggg atggtcccta ttccaccttc ctgactagct ctcccatccg ctcccgatct cctcctgcct ga. It is sometimes possible for the material contained within the vial of "ODF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
