Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ODAM cdna clone

ODAM cDNA Clone

Gene Names
ODAM; APIN
Synonyms
ODAM; ODAM cDNA Clone; ODAM cdna clone
Ordering
For Research Use Only!
Sequence
atgccctatgtattctccttcaaaatgcctcaagagcaaggacagatgtttcaatactatccagtttacatggtcctaccctgggaacaacctcagcaaacagttccaaggtcacctcaacaaacaagacagcaacagtatgaggagcagataccattctatgctcaatttggatacattccacaactagcagaacctgctatatcaggaggacagcagcaactagcttttgatccccaactaggcacagctcctgaaattgctgtgatgtcaacaggagaagagataccatatttacaaaaagaagcgatcaactttagacatgacagtgcaggagttttcatgccctcaacttcaccaaaacccagcacaaccaatgttttcacttctgctgtagaccaaactattaccccagagctcccagaagagaaggacaagactgacagcctaagggaaccataa
Sequence Length
462
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,777 Da
NCBI Official Full Name
Homo sapiens odontogenic, ameloblast asssociated, mRNA
NCBI Official Synonym Full Names
odontogenic, ameloblast asssociated
NCBI Official Symbol
ODAM
NCBI Official Synonym Symbols
APIN
NCBI Protein Information
odontogenic ameloblast-associated protein
UniProt Protein Name
Odontogenic ameloblast-associated protein
UniProt Gene Name
ODAM
UniProt Synonym Gene Names
APIN
UniProt Entry Name
ODAM_HUMAN

Uniprot Description

ODAM: Tooth-associated epithelia protein that probably plays a role in odontogenesis, the complex process that results in the initiation and generation of the tooth. May be incorporated in the enamel matrix at the end of mineralization process. Belongs to the ODAM family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: cytoplasm; extracellular region; extracellular space; fibril; nucleus

Molecular Function: protein binding

Biological Process: cellular protein metabolic process; inflammatory response; odontogenesis of dentine-containing teeth; positive regulation of epithelial cell proliferation involved in wound healing; positive regulation of GTPase activity; positive regulation of protein amino acid phosphorylation; regulation of actin cytoskeleton organization and biogenesis

Research Articles on ODAM

Similar Products

Product Notes

The ODAM odam (Catalog #AAA1278355) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctatg tattctcctt caaaatgcct caagagcaag gacagatgtt tcaatactat ccagtttaca tggtcctacc ctgggaacaa cctcagcaaa cagttccaag gtcacctcaa caaacaagac agcaacagta tgaggagcag ataccattct atgctcaatt tggatacatt ccacaactag cagaacctgc tatatcagga ggacagcagc aactagcttt tgatccccaa ctaggcacag ctcctgaaat tgctgtgatg tcaacaggag aagagatacc atatttacaa aaagaagcga tcaactttag acatgacagt gcaggagttt tcatgccctc aacttcacca aaacccagca caaccaatgt tttcacttct gctgtagacc aaactattac cccagagctc ccagaagaga aggacaagac tgacagccta agggaaccat aa. It is sometimes possible for the material contained within the vial of "ODAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.