OASL cdna clone
OASL cDNA Clone
Gene Names
OASL; OASLd; TRIP14; TRIP-14; p59OASL; p59 OASL; p59-OASL
Synonyms
OASL; OASL cDNA Clone; OASL cdna clone
Sequence
atggcactgatgcaggaactgtatagcacaccagcctccaggctggactccttcgtggctcagtggctgcagccccaccgggagtggaaggaagaggtgctagacgctgtgcggaccgtggaggagtttctgaggcaggagcatttccaggggaagcgtgggctggaccaggatgtgcgggtgctgaaggtagtcaaggtgggctccttcgggaatggcacggttctcaggagcaccagagaggtggagctggtggcgtttctgagctgtttccacagcttccaggaggcagccaagcatcacaaagatgttctgaggctgatatggaaaaccatgtggcaaagccaggacctgctggacctcgggctcgaggacctgaggatggagcagagagtccccgatgctcttgtcttcaccatccagaccagggggactgcggagcccatcacggtcaccattgtgcctgcctacagagccctggggccttctcttcccaactcccagccaccccctgaggtctatgtgagcctgatcaaggcctgcggtggtcctggaaatttctgcccatccttcagcgagctgcagagaaatttcgtgaaacatcggccaactaagctgaagagcctcctgcgcctggtgaaacactggtaccagcagtatgtgaaagccaggtcccccagagccaatctgccccctctctatgctcttgaacttctaaccatctatgcctgggaaatgggtactgaagaagacgagaatttcatgttggacgaaggcttcaccactgtgatggacctgctcctggagtatgaagtcatctgtatctactggaccaagtactacacactccacaatgcaatcattgaggattgtgtcagaaaacagctcaaaaaagagaggcccatcatcctggatccggccgaccccaccctcaacgtggcagaagggtacagatgggacatcgttgctcagagggcctcccagtgcctgaaacaggactgttgctatgacaacagggagaaccccatctccagctggaacgtgaagagggcacgagacatccacttgacagtggagcagaggggttacccagatttcaacctcatcgtgaacccttatgagcccataaggaaggttaaagagaaaatccggaggaccaggggctactctggcctgcagcgtctgtccttccaggttcctggcagtgagaggcagcttctcagcagcaggtgctccttagccaaatatgggatcttctcccacactcacatctatctgctggagaccatcccctccgagatccaggtcttcgtgaagaatcctgatggtgggagctacgcctatgccatcaaccccaacagcttcatcctgggtctgaagcagcagattgaagaccagcaggggcttcctaaaaagcagcagcagctggaattccaaggccaagtcctgcaggactggttgggtctggggatctatggcatccaagacagtgacactctcatcctctcgaagaagaaaggagaggctctgtttccagccagttag
Sequence Length
1545
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,942 Da
NCBI Official Full Name
Homo sapiens 2'-5'-oligoadenylate synthetase-like, mRNA
NCBI Official Synonym Full Names
2'-5'-oligoadenylate synthetase like
NCBI Official Symbol
OASL
NCBI Official Synonym Symbols
OASLd; TRIP14; TRIP-14; p59OASL; p59 OASL; p59-OASL
NCBI Protein Information
2'-5'-oligoadenylate synthase-like protein
UniProt Protein Name
2'-5'-oligoadenylate synthase-like protein
Protein Family
UniProt Gene Name
OASL
UniProt Synonym Gene Names
TRIP14; 2'-5'-OAS-RP; TR-interacting protein 14; TRIP-14; p59OASL
UniProt Entry Name
OASL_HUMAN
Uniprot Description
OASL: a protein of the 2'-5'-oligoadenylate synthetase family, but does not have 2'-5'-OAS activity. Binds double-stranded RNA and DNA. Interacts with the ligand binding domain of the thyroid receptor (TR). Does not require the presence of thyroid hormone for its interaction. Contains a ubiquitin-like domain that interacts with methyl CpG-binding protein 1.
Protein type: DNA-binding; Nucleolus
Chromosomal Location of Human Ortholog: 12q24.2
Cellular Component: cytoplasm; cytosol; membrane; nucleolus
Molecular Function: 2'-5'-oligoadenylate synthetase activity; DNA binding; double-stranded RNA binding; thyroid hormone receptor binding
Biological Process: negative regulation of viral genome replication; response to virus
Research Articles on OASL
Similar Products
Product Notes
The OASL oasl (Catalog #AAA1270919) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcactga tgcaggaact gtatagcaca ccagcctcca ggctggactc cttcgtggct cagtggctgc agccccaccg ggagtggaag gaagaggtgc tagacgctgt gcggaccgtg gaggagtttc tgaggcagga gcatttccag gggaagcgtg ggctggacca ggatgtgcgg gtgctgaagg tagtcaaggt gggctccttc gggaatggca cggttctcag gagcaccaga gaggtggagc tggtggcgtt tctgagctgt ttccacagct tccaggaggc agccaagcat cacaaagatg ttctgaggct gatatggaaa accatgtggc aaagccagga cctgctggac ctcgggctcg aggacctgag gatggagcag agagtccccg atgctcttgt cttcaccatc cagaccaggg ggactgcgga gcccatcacg gtcaccattg tgcctgccta cagagccctg gggccttctc ttcccaactc ccagccaccc cctgaggtct atgtgagcct gatcaaggcc tgcggtggtc ctggaaattt ctgcccatcc ttcagcgagc tgcagagaaa tttcgtgaaa catcggccaa ctaagctgaa gagcctcctg cgcctggtga aacactggta ccagcagtat gtgaaagcca ggtcccccag agccaatctg ccccctctct atgctcttga acttctaacc atctatgcct gggaaatggg tactgaagaa gacgagaatt tcatgttgga cgaaggcttc accactgtga tggacctgct cctggagtat gaagtcatct gtatctactg gaccaagtac tacacactcc acaatgcaat cattgaggat tgtgtcagaa aacagctcaa aaaagagagg cccatcatcc tggatccggc cgaccccacc ctcaacgtgg cagaagggta cagatgggac atcgttgctc agagggcctc ccagtgcctg aaacaggact gttgctatga caacagggag aaccccatct ccagctggaa cgtgaagagg gcacgagaca tccacttgac agtggagcag aggggttacc cagatttcaa cctcatcgtg aacccttatg agcccataag gaaggttaaa gagaaaatcc ggaggaccag gggctactct ggcctgcagc gtctgtcctt ccaggttcct ggcagtgaga ggcagcttct cagcagcagg tgctccttag ccaaatatgg gatcttctcc cacactcaca tctatctgct ggagaccatc ccctccgaga tccaggtctt cgtgaagaat cctgatggtg ggagctacgc ctatgccatc aaccccaaca gcttcatcct gggtctgaag cagcagattg aagaccagca ggggcttcct aaaaagcagc agcagctgga attccaaggc caagtcctgc aggactggtt gggtctgggg atctatggca tccaagacag tgacactctc atcctctcga agaagaaagg agaggctctg tttccagcca gttag. It is sometimes possible for the material contained within the vial of "OASL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
