NXT1 cdna clone

NXT1

Cat. Num. AAA200666

• Gene Names: NXT1; P15; MTR2
• Synonyms: NXT1; MTR2; P15; NXT1 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGCATCTGTGGATTTCAAGACCTATGTGGATCAGGCCTGCAGAGCTGCTGAGGAGTTTGTCAATGTCTACTACACCACCATGGATAAGCGGCGGCGTTTGCTGTCCCGCCTGTACATGGGCACAGCCACCCTGGTCTGGAATGGCAATGCTGTTTCAGGACAAGAATCCTTGAGTGAGTTTTTTGAAATGTTGCCTTCCAGCGAGTTCCAAATCAGCGTGGTAGACTGCCAGCCTGTTCATGATGAAGCCACACCAAGCCAGACCACGGTCCTTGTTGTCATCTGTGGATCAGTGAAGTTTGAGGGGAACAAACAACGGGACTTCAACCAGAACTTCATCCTGACCGCCCAGGCCTCACCCAGCAACACAGTGTGGAAGATCGCAAGTGACTGCTTCCGCTTCCAGGACTGGGCCAGCTAG; ; Translation Sequence: MASVDFKTYV DQACRAAEEF VNVYYTTMDK RRRLLSRLYM GTATLVWNGN AVSGQESLSEFFEMLPSSEF QISVVDCQPV HDEATPSQTT VLVVICGSVK FEGNKQRDFN QNFILTAQASPSNTVWKIAS DCFRFQDWAS
• Sequence Length: 140

• Species: Human
• Chromosome Location: 20p12-p11.2
• OMIM Reference Number: 605811
• cDNA Size: 423bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for NXT1 cdna clone

NXT1 encoded by this gene is located in the nuclear envelope. NXT1 has protein similarity to nuclear transport factor 2. NXT1 functions as a nuclear export factor in both RAN (Ras-related nuclear protein)-and CRM1 (required for chromosome region maintenance) -dependent pathways. It is found to stimulate the export of U1 snRNA in RAN- and CRM1-dependent pathways and the export of tRNA and mRNA in a CRM1-independent pathway. The encoded protein heterodimerizes with Tap protein and may regulate the ability of Tap protein to mediate nuclear mRNA export. The use of alternate polyadenylation sites has been found for NXT1.

Product Categories/Family for NXT1 cdna clone

Signal Transduction; Transportation

NCBI and Uniprot Product Information

• NCBI GI #: 7019471
• NCBI GeneID: 29107
• NCBI Accession #: NP_037380.1
• NCBI GenBank Nucleotide #: NM_013248.2
• UniProt Accession #: Q9UKK6
• NCBI Official Full Name: NTF2-related export protein 1
• NCBI Official Synonym Full Names: nuclear transport factor 2 like export factor 1
• NCBI Official Symbol: NXT1
• NCBI Official Synonym Symbols: P15; MTR2
• NCBI Protein Information: NTF2-related export protein 1
• UniProt Protein Name: NTF2-related export protein 1
• Protein Family: NTF2-related export protein
• UniProt Gene Name: NXT1
• UniProt Entry Name: NXT1_HUMAN

NCBI Description

The protein encoded by this gene is located in the nuclear envelope. It has protein similarity to nuclear transport factor 2. This protein functions as a nuclear export factor in both RAN (Ras-related nuclear protein)- and CRM1 (required for chromosome region maintenance)-dependent pathways. It is found to stimulate the export of U1 snRNA in RAN- and CRM1-dependent pathways and the export of tRNA and mRNA in a CRM1-independent pathway. The encoded protein heterodimerizes with Tap protein and may regulate the ability of Tap protein to mediate nuclear mRNA export. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

NXT1: Stimulator of protein export for NES-containing proteins. Also plays a role in the nuclear export of U1 snRNA, tRNA, and mRNA. The NXF1-NXT1 heterodimer is involved in the export of HSP70 mRNA in conjunction with ALYREF/THOC4 and THOC5.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 20p12-p11.2

Cellular Component: cytoplasm; nuclear speck; nuclear pore

Molecular Function: protein binding; Ran GTPase binding

Biological Process: RNA export from nucleus; protein export from nucleus