Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NXPH1 cdna clone

NXPH1 cDNA Clone

Gene Names
NXPH1; NPH1; Nbla00697
Synonyms
NXPH1; NXPH1 cDNA Clone; NXPH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggctgcgtgctggtacgtgcttttcctcctgcagcccaccgtctacttggtcacatgtgccaatttaacgaacggtggaaagtcagaacttctgaaatcaggaagcagcaaatccacactaaagcacatatggacagaaagcagcaaagacttgtctatcagccgactcctgtcacagacttttcgtggcaaagagaatgatacagatttggacctgagatatgacaccccagaaccttattctgagcaagacctctgggactggctgaggaactccacagaccttcaagagcctcggcccagggccaagagaaggcccattgttaaaacgggcaagtttaagaaaatgtttggatggggcgattttcattccaacatcaaaacagtgaagctgaacctgttgataactgggaaaattgtagatcatggcaatgggacatttagtgtttatttcaggcataattcaactggtcaagggaatgtatctgtcagcttggtaccccctacaaaaatcgtggaatttgacttggcacaacaaaccgtgattgatgccaaagattccaagtcttttaattgtcgcattgaatatgaaaaggttgacaaggctaccaagaacacactctgcaactatgacccttcaaaaacctgttaccaggagcaaacccaaagtcatgtatcctggctctgctccaagccctttaaggtgatctgtatttacatttccttttatagtacagattataaactggtacagaaagtgtgccctgactacaactaccacagtgacacaccttactttccctcgggatga
Sequence Length
816
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,082 Da
NCBI Official Full Name
Homo sapiens neurexophilin 1, mRNA
NCBI Official Synonym Full Names
neurexophilin 1
NCBI Official Symbol
NXPH1
NCBI Official Synonym Symbols
NPH1; Nbla00697
NCBI Protein Information
neurexophilin-1
UniProt Protein Name
Neurexophilin-1
Protein Family
UniProt Gene Name
NXPH1
UniProt Synonym Gene Names
NPH1
UniProt Entry Name
NXPH1_HUMAN

NCBI Description

This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. [provided by RefSeq, Jul 2008]

Uniprot Description

NXPH1: May be signaling molecules that resemble neuropeptides and that act by binding to alpha-neurexins and possibly other receptors (Potential). Belongs to the neurexophilin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 7p22

Research Articles on NXPH1

Similar Products

Product Notes

The NXPH1 nxph1 (Catalog #AAA1277699) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggctg cgtgctggta cgtgcttttc ctcctgcagc ccaccgtcta cttggtcaca tgtgccaatt taacgaacgg tggaaagtca gaacttctga aatcaggaag cagcaaatcc acactaaagc acatatggac agaaagcagc aaagacttgt ctatcagccg actcctgtca cagacttttc gtggcaaaga gaatgataca gatttggacc tgagatatga caccccagaa ccttattctg agcaagacct ctgggactgg ctgaggaact ccacagacct tcaagagcct cggcccaggg ccaagagaag gcccattgtt aaaacgggca agtttaagaa aatgtttgga tggggcgatt ttcattccaa catcaaaaca gtgaagctga acctgttgat aactgggaaa attgtagatc atggcaatgg gacatttagt gtttatttca ggcataattc aactggtcaa gggaatgtat ctgtcagctt ggtaccccct acaaaaatcg tggaatttga cttggcacaa caaaccgtga ttgatgccaa agattccaag tcttttaatt gtcgcattga atatgaaaag gttgacaagg ctaccaagaa cacactctgc aactatgacc cttcaaaaac ctgttaccag gagcaaaccc aaagtcatgt atcctggctc tgctccaagc cctttaaggt gatctgtatt tacatttcct tttatagtac agattataaa ctggtacaga aagtgtgccc tgactacaac taccacagtg acacacctta ctttccctcg ggatga. It is sometimes possible for the material contained within the vial of "NXPH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.