NXF3 cdna clone
NXF3 cDNA Clone
Synonyms
NXF3; NXF3 cDNA Clone; NXF3 cdna clone
Sequence
atgtcactgccttcaggacacactacgggtcacactgatcaagttgttcaaagaagagcaagatgttgggatatttaccaaaggagatttagcagtaggtctgaacctgtcaatcctggcatgcattcttcatcccatcagcagcaagatggagatgcagcaatgcatggtgcccacatggactctccagtaagatacactccctatactatttcaccctataatcggaaaggcagttttcgtaaacaagaccaaacccacgttaacatggagagagagcaaaaacctccagagagaagaatggaggggaacatgccggatgggaccttagggagctggttcaagatcacagttccctttggcataaaatacaatgagaagtggctgctgaatttgattcagaatgaatgcagtgtacccttcgtcccagttgagtttcactatgaaaacatgcatgccagcttctttgtggagaatgccagcatcgcctatgcactgaagaatgtcagtggcaagatttgggatgaggataatgaaaagatatcaatctttgtcaaccctgctggcataccccactttgtgcacagggagctgaagtcagaaaaggtggagcagataaagctggccatgaaccaacagtgtgatgtctcccaggaagctcttgatatccagagactcccattttacccagacatggtgaaccgtgatactaagatggcatcgaatcctagaaagtgcatggctgcctccctggacgtccatgaagagaacatacctacagtgatgtctgcaggggagatggacaagtggaaagggatagagccaggagagaagtgtgcggacagaagcccagtgtgcacgaccttctcggatacctccagcaacataaactccatcctggaattgttccccaaattattatgcctggatggccagcagtcacccagagcaactttatgtggtactgaagcccacaagaggttaccaacctgtaagggaagcttctttggatctgagatgttgaagaatctggtcctgcaattcctgcagcagtattacttgatctatgactctggagatcgacagggtctccttagtgcttaccacgatgaggcctgcttctccctgagcattcccttcaatcctgaggactcagccccgagcagcttctgcaagttcttcaaggatagcaggaatataaaaattctcaaggacccctaccttcggggggagctgctgaagcacacaaaacttgatattgtggactccctcagtgcgttgcctaaaactcagcatgacctcagctccttcctggtggacatgtggtaccagacggaatggatgctctgcttttctgtcaacggggtgttcaaggaagtggaaggacagtctcagggttctgttctcgccttcacccggaccttcattgctacccctggcagcagttccagtctgtgcatcgtgaatgacaagctctttgtgcgggataccagccaccaagggacccagagtgccttgttcaccctagtgcccacagccttctccagctccgtgcctgccttctcccaggagcagcagaaaatgctgccttcgtaa
Sequence Length
1596
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,653 Da
NCBI Official Full Name
Homo sapiens nuclear RNA export factor 3, mRNA
NCBI Official Synonym Full Names
nuclear RNA export factor 3
NCBI Official Symbol
NXF3
NCBI Protein Information
nuclear RNA export factor 3
UniProt Protein Name
Nuclear RNA export factor 3
Protein Family
UniProt Gene Name
NXF3
UniProt Synonym Gene Names
TAPL3; TAPL-3
UniProt Entry Name
NXF3_HUMAN
NCBI Description
This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene has shortened LRR and ubiquitin-associated domains and its RDB is unable to bind RNA. It is located in the nucleoplasm but is not associated with either the nuclear envelope or the nucleolus. [provided by RefSeq, Jul 2008]
Uniprot Description
NXF3: May function as a tissue-specific nuclear mRNA export factor. Belongs to the NXF family.
Chromosomal Location of Human Ortholog: Xq22
Cellular Component: cytoplasm; nuclear RNA export factor complex; nucleoplasm; nucleus
Molecular Function: protein binding
Biological Process: mRNA export from nucleus; poly(A)+ mRNA export from nucleus
Similar Products
Product Notes
The NXF3 nxf3 (Catalog #AAA1268854) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcactgc cttcaggaca cactacgggt cacactgatc aagttgttca aagaagagca agatgttggg atatttacca aaggagattt agcagtaggt ctgaacctgt caatcctggc atgcattctt catcccatca gcagcaagat ggagatgcag caatgcatgg tgcccacatg gactctccag taagatacac tccctatact atttcaccct ataatcggaa aggcagtttt cgtaaacaag accaaaccca cgttaacatg gagagagagc aaaaacctcc agagagaaga atggagggga acatgccgga tgggacctta gggagctggt tcaagatcac agttcccttt ggcataaaat acaatgagaa gtggctgctg aatttgattc agaatgaatg cagtgtaccc ttcgtcccag ttgagtttca ctatgaaaac atgcatgcca gcttctttgt ggagaatgcc agcatcgcct atgcactgaa gaatgtcagt ggcaagattt gggatgagga taatgaaaag atatcaatct ttgtcaaccc tgctggcata ccccactttg tgcacaggga gctgaagtca gaaaaggtgg agcagataaa gctggccatg aaccaacagt gtgatgtctc ccaggaagct cttgatatcc agagactccc attttaccca gacatggtga accgtgatac taagatggca tcgaatccta gaaagtgcat ggctgcctcc ctggacgtcc atgaagagaa catacctaca gtgatgtctg caggggagat ggacaagtgg aaagggatag agccaggaga gaagtgtgcg gacagaagcc cagtgtgcac gaccttctcg gatacctcca gcaacataaa ctccatcctg gaattgttcc ccaaattatt atgcctggat ggccagcagt cacccagagc aactttatgt ggtactgaag cccacaagag gttaccaacc tgtaagggaa gcttctttgg atctgagatg ttgaagaatc tggtcctgca attcctgcag cagtattact tgatctatga ctctggagat cgacagggtc tccttagtgc ttaccacgat gaggcctgct tctccctgag cattcccttc aatcctgagg actcagcccc gagcagcttc tgcaagttct tcaaggatag caggaatata aaaattctca aggaccccta ccttcggggg gagctgctga agcacacaaa acttgatatt gtggactccc tcagtgcgtt gcctaaaact cagcatgacc tcagctcctt cctggtggac atgtggtacc agacggaatg gatgctctgc ttttctgtca acggggtgtt caaggaagtg gaaggacagt ctcagggttc tgttctcgcc ttcacccgga ccttcattgc tacccctggc agcagttcca gtctgtgcat cgtgaatgac aagctctttg tgcgggatac cagccaccaa gggacccaga gtgccttgtt caccctagtg cccacagcct tctccagctc cgtgcctgcc ttctcccagg agcagcagaa aatgctgcct tcgtaa. It is sometimes possible for the material contained within the vial of "NXF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
