Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUP50 cdna clone

NUP50 cDNA Clone

Gene Names
NUP50; NPAP60; NPAP60L
Synonyms
NUP50; NUP50 cDNA Clone; NUP50 cdna clone
Ordering
For Research Use Only!
Sequence
atggccagtgaggaagtcttgaagaatagagccataaagaaagcaaagcgcagaaatgttggatttgaatctgacactggaggagcctttaaaggttttaaaggtttggttgtaccttctggaggaggacgcttttctggatttggtagtggcgctggagggaagcctttggaaggactgtcgaatggaaacaacataaccagtgcccctcccttcgccagtgcaaaggcagcggcagatcccaaggtagcctttggttctcttgctgcaaatggccctaccaccttggttgataaagtttcaaatcccaaaactaatggggacagtcagcagccctcctcctctggccttgcttccagtaaagcttgtgtcggaaatgcctatcacaagcagttggccgccttgaactgctccgtgcgggattggatagtgaagcacgtgaatacaaaccccctctgtgatctgacacctatctttaaagactatgagaaatatttagcaaacattgaacagcaacacgggaacagtggcaggaattctgaaagtgaatctaacaaagtggcagctgaaacacagtctccttccctttttggctcaacaaaattacagcaagagtcaacgtttttgtttcatggcaacaaaactgaagatacacctgacaagaagatggaggtggcatctgaaaagaaaacggacccatcatcactaggagcgacaagtgcctcatttaatttcggcaagaaagttgatagctctgttttgggctcattaagctctgtccccctgactggattttctttctcccctggaaactccagtttatttggcaaagatactacccagagtaaaccagtctcttcaccatttcccactaaaccattggagggccaagcagaaggtgacagtggtgaatgcaaaggtggagatgaagaagagaatgatgagccacccaaagtagtagttaccgaagtaaaagaagaagacgctttttactccaaaaagtgtaaactgttttacaagaaagacaatgagtttaaagagaaaggcataggtactctgcatttaaaacctacagcaaatcagaagacacagcttttggtgcgggcagacaccaatttaggcaacatattgctgaacgttctgattccacccaatatgccatgtacgcgaacagggaagaataacgttcttatcgtctgtgttccaaatccaccaattgacgagaagaatgccaccatgccagtcaccatgttgattcgggtaaaaaccagcgaggatgcagacgagttgcacaaaattttactggagaaaaaggatgcctga
Sequence Length
1323
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,863 Da
NCBI Official Full Name
Homo sapiens nucleoporin 50kDa, mRNA
NCBI Official Synonym Full Names
nucleoporin 50
NCBI Official Symbol
NUP50
NCBI Official Synonym Symbols
NPAP60; NPAP60L
NCBI Protein Information
nuclear pore complex protein Nup50
UniProt Protein Name
Nuclear pore complex protein Nup50
UniProt Gene Name
NUP50
UniProt Synonym Gene Names
NPAP60L
UniProt Entry Name
NUP50_HUMAN

NCBI Description

The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins that functions as a soluble cofactor in importin-alpha:beta-mediated nuclear protein import. Pseudogenes of this gene are found on chromosomes 5, 6, and 14. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

NUP50: Component of the nuclear pore complex that has a direct role in nuclear protein import. Actively displaces NLSs from importin-alpha, and facilitates disassembly of the importin- alpha:beta-cargo complex and importin recycling. Interacts with multiple transport receptor proteins including CDKN1B. This interaction is required for correct intracellular transport and degradation of CDKN1B. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleoporin; Nuclear import

Chromosomal Location of Human Ortholog: 22q13.31

Cellular Component: cytoplasm; nuclear membrane; nucleoplasm

Molecular Function: protein binding; Ran GTPase binding

Biological Process: mitotic nuclear envelope disassembly; mRNA export from nucleus; protein import into nucleus; protein sumoylation; RNA-mediated gene silencing; tRNA export from nucleus; viral reproduction; viral transcription

Research Articles on NUP50

Similar Products

Product Notes

The NUP50 nup50 (Catalog #AAA1266505) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagtg aggaagtctt gaagaataga gccataaaga aagcaaagcg cagaaatgtt ggatttgaat ctgacactgg aggagccttt aaaggtttta aaggtttggt tgtaccttct ggaggaggac gcttttctgg atttggtagt ggcgctggag ggaagccttt ggaaggactg tcgaatggaa acaacataac cagtgcccct cccttcgcca gtgcaaaggc agcggcagat cccaaggtag cctttggttc tcttgctgca aatggcccta ccaccttggt tgataaagtt tcaaatccca aaactaatgg ggacagtcag cagccctcct cctctggcct tgcttccagt aaagcttgtg tcggaaatgc ctatcacaag cagttggccg ccttgaactg ctccgtgcgg gattggatag tgaagcacgt gaatacaaac cccctctgtg atctgacacc tatctttaaa gactatgaga aatatttagc aaacattgaa cagcaacacg ggaacagtgg caggaattct gaaagtgaat ctaacaaagt ggcagctgaa acacagtctc cttccctttt tggctcaaca aaattacagc aagagtcaac gtttttgttt catggcaaca aaactgaaga tacacctgac aagaagatgg aggtggcatc tgaaaagaaa acggacccat catcactagg agcgacaagt gcctcattta atttcggcaa gaaagttgat agctctgttt tgggctcatt aagctctgtc cccctgactg gattttcttt ctcccctgga aactccagtt tatttggcaa agatactacc cagagtaaac cagtctcttc accatttccc actaaaccat tggagggcca agcagaaggt gacagtggtg aatgcaaagg tggagatgaa gaagagaatg atgagccacc caaagtagta gttaccgaag taaaagaaga agacgctttt tactccaaaa agtgtaaact gttttacaag aaagacaatg agtttaaaga gaaaggcata ggtactctgc atttaaaacc tacagcaaat cagaagacac agcttttggt gcgggcagac accaatttag gcaacatatt gctgaacgtt ctgattccac ccaatatgcc atgtacgcga acagggaaga ataacgttct tatcgtctgt gttccaaatc caccaattga cgagaagaat gccaccatgc cagtcaccat gttgattcgg gtaaaaacca gcgaggatgc agacgagttg cacaaaattt tactggagaa aaaggatgcc tga. It is sometimes possible for the material contained within the vial of "NUP50, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.