Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUF2 cdna clone

NUF2 cDNA Clone

Gene Names
NUF2; CDCA1; CT106; NUF2R
Synonyms
NUF2; NUF2 cDNA Clone; NUF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaactttgtctttccccagatataatgtagctgagattgtgattcatattcgcaataagatcttaacaggagctgatggtaaaaacctcaccaagaatgatctttatccaaatccaaagcctgaagtcttgcacatgatctacatgagagccttacaaatagtatatggaattcgactggaacatttttacatgatgccagtgaactctgaagtcatgtatccacatttaatggaaggcttcttaccattcagcaatttagttactcatctggactcatttttgcctatctgccgggtgaatgactttgagactgctgatattctatgtccaaaagcaaaacggacaagtcggtttttaagtggcattatcaactttattcacttcagagaagcatgccgtgaaacgtatatggaatttctttggcaatataaatcctctgcggacaaaatgcaacagttaaacgccgcacaccaggaggcattaatgaaactggagagacttgattctgttccagttgaagagcaagaagagttcaagcagctttcagatggaattcaggagctacaacaatcactaaatcaggattttcatcaaaaaacgatagtgctgcaagagggaaattcccaaaagaagtcaaatatttcagagaaaaccaagcgtttgaatgaactaaaattgtcggtggtttctttgaaagaaatacaagagagtttgaaaacaaaaattgtggattctccagagaagttaaagaattataaagaaaaaatgaaagatacggtccagaagcttaaaaatgccagacaagaagtggtggagaaatatgaaatctatggagactcagttgactgcctgccttcatgtcagttggaagtgcagttatatcaaaagaaaatacaggacctttcagataatagggaaaaattagccagtatcttaaaggagagcctgaacttggaggaccaaattgagagtgatgagtcagaactgaagaaattgaagactgaagaaaattcgttcaaaagactgatgattgtgaagaaggaaaaacttgccacagcacaattcaaaataaataagaagcatgaagatgttaagcaatacaaacgcacagtaattgaggattgcaataaagttcaagaaaaaagaggtgctgtctatgaacgagtaaccacaattaatcaagaaatccaaaaaattaaacttggaattcaacaactaaaagatgctgctgaaagggagaaactgaagtcccaggaaatatttctaaacttgaaaactgctttggagaaataccacgacggtattgaaaaggcagcagaggactcctatgctaagatagatgagaagacagctgaactgaagaggaagatgttcaaaatgtcaacctga
Sequence Length
1395
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,304 Da
NCBI Official Full Name
Homo sapiens NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
NUF2, NDC80 kinetochore complex component
NCBI Official Symbol
NUF2
NCBI Official Synonym Symbols
CDCA1; CT106; NUF2R
NCBI Protein Information
kinetochore protein Nuf2
UniProt Protein Name
Kinetochore protein Nuf2
Protein Family
UniProt Gene Name
NUF2
UniProt Synonym Gene Names
CDCA1; NUF2R; hNuf2; hNuf2R; hsNuf2
UniProt Entry Name
NUF2_HUMAN

NCBI Description

This gene encodes a protein that is highly similar to yeast Nuf2, a component of a conserved protein complex associated with the centromere. Yeast Nuf2 disappears from the centromere during meiotic prophase when centromeres lose their connection to the spindle pole body, and plays a regulatory role in chromosome segregation. The encoded protein is found to be associated with centromeres of mitotic HeLa cells, which suggests that this protein is a functional homolog of yeast Nuf2. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

NUF2: Acts as a component of the essential kinetochore- associated NDC80 complex, which is required for chromosome segregation and spindle checkpoint activity. Required for kinetochore integrity and the organization of stable microtubule binding sites in the outer plate of the kinetochore. Belongs to the NUF2 family.

Protein type: Cancer Testis Antigen (CTA); DNA replication

Chromosomal Location of Human Ortholog: 1q23.3

Cellular Component: cytosol; membrane; nucleus

Molecular Function: protein binding

Biological Process: sister chromatid cohesion

Research Articles on NUF2

Similar Products

Product Notes

The NUF2 nuf2 (Catalog #AAA1274328) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaactt tgtctttccc cagatataat gtagctgaga ttgtgattca tattcgcaat aagatcttaa caggagctga tggtaaaaac ctcaccaaga atgatcttta tccaaatcca aagcctgaag tcttgcacat gatctacatg agagccttac aaatagtata tggaattcga ctggaacatt tttacatgat gccagtgaac tctgaagtca tgtatccaca tttaatggaa ggcttcttac cattcagcaa tttagttact catctggact catttttgcc tatctgccgg gtgaatgact ttgagactgc tgatattcta tgtccaaaag caaaacggac aagtcggttt ttaagtggca ttatcaactt tattcacttc agagaagcat gccgtgaaac gtatatggaa tttctttggc aatataaatc ctctgcggac aaaatgcaac agttaaacgc cgcacaccag gaggcattaa tgaaactgga gagacttgat tctgttccag ttgaagagca agaagagttc aagcagcttt cagatggaat tcaggagcta caacaatcac taaatcagga ttttcatcaa aaaacgatag tgctgcaaga gggaaattcc caaaagaagt caaatatttc agagaaaacc aagcgtttga atgaactaaa attgtcggtg gtttctttga aagaaataca agagagtttg aaaacaaaaa ttgtggattc tccagagaag ttaaagaatt ataaagaaaa aatgaaagat acggtccaga agcttaaaaa tgccagacaa gaagtggtgg agaaatatga aatctatgga gactcagttg actgcctgcc ttcatgtcag ttggaagtgc agttatatca aaagaaaata caggaccttt cagataatag ggaaaaatta gccagtatct taaaggagag cctgaacttg gaggaccaaa ttgagagtga tgagtcagaa ctgaagaaat tgaagactga agaaaattcg ttcaaaagac tgatgattgt gaagaaggaa aaacttgcca cagcacaatt caaaataaat aagaagcatg aagatgttaa gcaatacaaa cgcacagtaa ttgaggattg caataaagtt caagaaaaaa gaggtgctgt ctatgaacga gtaaccacaa ttaatcaaga aatccaaaaa attaaacttg gaattcaaca actaaaagat gctgctgaaa gggagaaact gaagtcccag gaaatatttc taaacttgaa aactgctttg gagaaatacc acgacggtat tgaaaaggca gcagaggact cctatgctaa gatagatgag aagacagctg aactgaagag gaagatgttc aaaatgtcaa cctga. It is sometimes possible for the material contained within the vial of "NUF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.